PDPN (NM_001006624) Human Untagged Clone
CAT#: SC301085
PDPN (untagged)-Human podoplanin (PDPN), transcript variant 3
CNY 1,920.00
Cited in 1 publication. |
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AGGRUS; GP36; Gp38; GP40; HT1A-1; OTS8; PA2.26; T1A; T1A-2; T1A2; TI1A |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001006624, the custom clone sequence may differ by one or more nucleotides
ATGCCAGGTGCCGAAGATGATGTGGTGACTCCAGGAACCAGCGAAGACCGCTATAAGTCT GGCTTGACAACTCTGGTGGCAACAAGTGTCAACAGTGTAACAGGCATTCGCATCGAGGAT CTGCCAACTTCAGAAAGCACAGTCCACGCGCAAGAACAAAGTCCAAGCGCCACAGCCTCA AACGTGGCCACCAGTCACTCCACGGAGAAAGTGGATGGAGACACACAGACAACAGTTGAG AAAGATGGTTTGTCAACAGTGACCCTGGTTGGAATCATAGTTGGGGTCTTACTAGCCATC GGCTTCATTGGTGCAATCATCGTTGTGGTTATGCGAAAAATGTCGGGAAGGTACTCGCCC TAA |
Restriction Sites | Please inquire |
ACCN | NM_001006624 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001006624.1, NP_001006625.1 |
RefSeq Size | 2652 bp |
RefSeq ORF | 363 bp |
Locus ID | 10630 |
UniProt ID | Q86YL7 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | This gene encodes a type-I integral membrane glycoprotein with diverse distribution in human tissues. The physiological function of this protein may be related to its mucin-type character. The homologous protein in other species has been described as a differentiation antigen and influenza-virus receptor. The specific function of this protein has not been determined but it has been proposed as a marker of lung injury. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3), contains a distinct 5' UTR and lacks an in-frame portion of the 5' coding region, compared to variant 1. The resulting isoform (c) has a shorter N-terminus when compared to isoform a. |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Up-Regulation of the Lymphatic Marker Podoplanin, a Mucin-Type Transmembrane Glycoprotein, in Human Squamous Cell Carcinomas and Germ Cell Tumors
,Vivien Schacht, Soheil S. Dadras, Louise A. Johnson, David G. Jackson, Young-Kwon Hong, and Michael Detmar,
Am. J. Pathol. 2005 Mar;166(3):913-21.
[PDPN]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212686 | PDPN (Myc-DDK-tagged)-Human podoplanin (PDPN), transcript variant 3 |
CNY 3,990.00 |
|
RC212686L3 | Lenti-ORF clone of PDPN (Myc-DDK-tagged)-Human podoplanin (PDPN), transcript variant 3 |
CNY 5,890.00 |
|
RC212686L4 | Lenti-ORF clone of PDPN (mGFP-tagged)-Human podoplanin (PDPN), transcript variant 3 |
CNY 5,890.00 |
|
RG212686 | PDPN (tGFP-tagged) - Human podoplanin (PDPN), transcript variant 3 |
CNY 4,370.00 |