PDPN (NM_001006625) Human Untagged Clone
CAT#: SC301086
PDPN (untagged)-Human podoplanin (PDPN), transcript variant 4
CNY 3,990.00
Cited in 1 publication. |
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AGGRUS; GP36; Gp38; GP40; HT1A-1; OTS8; PA2.26; T1A; T1A-2; T1A2; TI1A |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001006625, the custom clone sequence may differ by one or more nucleotides
ATGCCAGGTGCCGAAGATGATGTGGTGACTCCAGGAACCAGCGAAGACCGCTATAAGTCT GGCTTGACAACTCTGGTGGCAACAAGTGTCAACAGTGTAACAGGCATTCGCATCGAGGAT CTGCCAACTTCAGAAAGCACAGTCCACGCGCAAGAACAAAGTCCAAGCGCCACAGCCTCA AACGTGGCCACCAGTCACTCCACGGAGAAAGTGGATGGAGACACACAGACAACAGTTGAG AAAGATGGTTTGTCAACAGTGACCCTGGTTGGAATCATAGTTGGGGTCTTACTAGCCATC GGCTTCATTGGTGCAATCATCGTTGTGGTTATGCGAAAAATGTCGGGAAGGCCCTAA |
Restriction Sites | Please inquire |
ACCN | NM_001006625 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001006625.1, NP_001006626.1 |
RefSeq Size | 2646 bp |
RefSeq ORF | 357 bp |
Locus ID | 10630 |
UniProt ID | Q86YL7 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | This gene encodes a type-I integral membrane glycoprotein with diverse distribution in human tissues. The physiological function of this protein may be related to its mucin-type character. The homologous protein in other species has been described as a differentiation antigen and influenza-virus receptor. The specific function of this protein has not been determined but it has been proposed as a marker of lung injury. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (4), contains a distinct 5' UTR and has multiple differences in the coding region, compared to variant 1. The resulting isoform (d) is shorter and has a shorter N-terminus when compared to isoform a. |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Up-Regulation of the Lymphatic Marker Podoplanin, a Mucin-Type Transmembrane Glycoprotein, in Human Squamous Cell Carcinomas and Germ Cell Tumors
,Vivien Schacht, Soheil S. Dadras, Louise A. Johnson, David G. Jackson, Young-Kwon Hong, and Michael Detmar,
Am. J. Pathol. 2005 Mar;166(3):913-21.
[PDPN]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC224863 | PDPN (Myc-DDK-tagged)-Human podoplanin (PDPN), transcript variant 4 |
CNY 3,990.00 |
|
RC224863L3 | Lenti-ORF clone of PDPN (Myc-DDK-tagged)-Human podoplanin (PDPN), transcript variant 4 |
CNY 5,890.00 |
|
RC224863L4 | Lenti-ORF clone of PDPN (mGFP-tagged)-Human podoplanin (PDPN), transcript variant 4 |
CNY 5,890.00 |
|
RG224863 | PDPN (tGFP-tagged) - Human podoplanin (PDPN), transcript variant 4 |
CNY 4,370.00 |