APOBEC3F (NM_001006666) Human Untagged Clone
CAT#: SC301110
APOBEC3F (untagged)-Human apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3F (APOBEC3F), transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | A3F; ARP8; BK150C2.4.MRNA; KA6 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001006666, the custom clone sequence may differ by one or more nucleotides
ATGAAGCCTCACTTCAGAAACACAGTGGAGCGAATGTATCGAGACACATTCTCCTACAAC TTTTATAATAGACCCATCCTTTCTCGTCGGAATACCGTCTGGCTGTGCTACGAAGTGAAA ACAAAGGGTCCCTCAAGGCCCCGTTTGGACGCAAAGATCTTTCGAGGCCAGGTGCCCAGG TCTTTCATCAGAGCCCCATTTCAAGTGCTCAGTAGCCCCTTTGGCCAGTGCGCCCCACCA CATGGGACAGCGCAGGTCCAGTGGCCTCCCCAGCTGACCGCAGGCAGGGAACAAGGCAGA CCCTAG |
Restriction Sites | Please inquire |
ACCN | NM_001006666 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001006666.1, NP_001006667.1 |
RefSeq Size | 822 bp |
RefSeq ORF | 306 bp |
Locus ID | 200316 |
UniProt ID | Q8IUX4 |
Gene Summary | This gene is a member of the cytidine deaminase gene family. It is one of seven related genes or pseudogenes found in a cluster, thought to result from gene duplication, on chromosome 22. Members of the cluster encode proteins that are structurally and functionally related to the C to U RNA-editing cytidine deaminase APOBEC1. It is thought that the proteins may be RNA editing enzymes and have roles in growth or cell cycle control. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) contains a distinct 3' UTR and 3' coding region, compared to variant 1. The resulting isoform (b) is shorter and has a distinct C-terminus when compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212707 | APOBEC3F (Myc-DDK-tagged)-Human apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3F (APOBEC3F), transcript variant 2 |
CNY 3,990.00 |
|
RC212707L3 | Lenti-ORF clone of APOBEC3F (Myc-DDK-tagged)-Human apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3F (APOBEC3F), transcript variant 2 |
CNY 5,890.00 |
|
RC212707L4 | Lenti-ORF clone of APOBEC3F (mGFP-tagged)-Human apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3F (APOBEC3F), transcript variant 2 |
CNY 5,890.00 |
|
RG212707 | APOBEC3F (tGFP-tagged) - Human apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3F (APOBEC3F), transcript variant 2 |
CNY 2,920.00 |
其它APOBEC3F产品