TCEAL4 (NM_001006935) Human Untagged Clone

CAT#: SC301118

TCEAL4 (untagged)-Human transcription elongation factor A (SII)-like 4 (TCEAL4), transcript variant 2



  "NM_001006935" in other vectors (4)

CNY 2,400.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal anti-TCEAL4 antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms NPD017; WEX7
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC301118 representing NM_001006935.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAAAAACTCTACAGTGAAAATGAAGGAATGGCTTCAAACCAAGGAAAGATGGAAAATGAAGAACAG
CCACAAGACGAGAGAAAGCCAGAAGTAACTTGTACTCTGGAAGACAAGAAGTTAGAAAACGAGGGAAAG
ACAGAAAACAAGGGCAAAACAGGAGATGAGGAAATGTTAAAGGATAAAGGAAAGCCAGAGAGTGAGGGA
GAGGCAAAAGAAGGAAAGTCAGAGAGGGAGGGAGAGTCAGAGATGGAGGGAGGATCAGAGAGAGAGGGA
AAACCAGAGATAGAGGGAAAGCCAGAGAGTGAAGGAGAGCCAGGGAGTGAAACAAGGGCTGCAGGAAAG
CGCCCAGCTGAGGATGATGTACCCAGGAAAGCCAAAAGAAAAACTAATAAGGGGCTGGCTCATTACCTC
AAGGAGTATAAAGAGGCCATACATGATATGAATTTCAGCAATGAGGACATGATAAGAGAATTTGACAAT
ATGGCTAAGGTGCAGGATGAGAAGAGAAAAAGCAAACAGAAATTGGGGGCGTTTTTGTGGATGCAAAGA
AATTTACAGGACCCCTTCTACCCTAGAGGTCCAAGGGAATTCAGGGGTGGCTGCAGGGCCCCACGAAGG
GACATTGAAGACATTCCTTATGTGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001006935
Insert Size 648 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001006935.1
RefSeq Size 1294 bp
RefSeq ORF 648 bp
Locus ID 79921
UniProt ID Q96EI5
MW 24.6 kDa
Gene Summary This gene encodes a member of the transcription elongation factor A (SII)-like (TCEAL) gene family. This family is comprised of nuclear phosphoproteins that modulate transcription in a promoter context-dependent manner. Multiple family members are located on the X chromosome. Alternatively splicing results in multiple transcript variants. There is a pseudogene for this gene on chromosome 13. [provided by RefSeq, Apr 2015]
Transcript Variant: This variant (2) uses an alternate splice site in the 5' UTR compared to variant 1. Variants 1, 2, 4, 6, 7, and 8 encode the same isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...