GOSR1 (NM_001007024) Human Untagged Clone

CAT#: SC301133

GOSR1 (untagged)-Human golgi SNAP receptor complex member 1 (GOSR1), transcript variant 3



  "NM_001007024" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-GOSR1 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GOLIM2; GOS-28; GOS28; GOS28/P28; GS28; P28
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC301133 representing NM_001007024.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTTTGAGACAATGGCGATTGAGATTGAACAACTTTTGGCAAGGCTTACAGGGGTAAATGATAAAATG
GCAGAATATACCAACAGTGCAGGTGTCCCCTCCTTGAATGCAGCCCTGATGCATACATTACAGCGGCAT
AGAGACATATTGCAGGATTATACACATGAATTCCATAAAACCAAAGCAAACTTTATGGCAATACGGGAA
AGGGAGAATCTTATGGGATCAGTACGAAAAGATATTGAGTCATATAAAAGTGGGTCTGGAGTAAACAAC
AGAAGAACTGAGCTATTTTTGAAAGAACATGACCACCTTCGAAACTCAGATCGTCTGATAGAAGAGACA
ATAAGCATTGCTATGGCAACAAAAGAAAATATGACTTCACAGAGAGGAATGTTGAAGTCAATTCACAGC
AAAATGAACACTTTGGCCAATCGTTTTCCTGCTGTAAACAGCCTGATCCAGAGGATCAACCTGAGGAAG
CGGCGGGACTCGCTCATCCTAGGGGGTGTTATTGGGATCTGTACCATCCTGTTGCTGCTGTATGCGTTC
CATTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001007024
Insert Size 558 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001007024.1
RefSeq Size 5246 bp
RefSeq ORF 558 bp
Locus ID 9527
UniProt ID O95249
Protein Families Druggable Genome, Transmembrane
Protein Pathways SNARE interactions in vesicular transport
MW 21.2 kDa
Gene Summary This gene encodes a trafficking membrane protein which transports proteins among the endoplasmic reticulum and the Golgi and between Golgi compartments. This protein is considered an essential component of the Golgi SNAP receptor (SNARE) complex. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) has an additional segment in one exon and lacks a small segment in another exon in the 5' region, as compared to variant 1. It uses a downstream AUG start codon, and the encoded isoform 3 thus has a shorter N-terminus, as compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...