ZSCAN2 (NM_001007072) Human Untagged Clone
CAT#: SC301144
ZSCAN2 (untagged)-Human zinc finger and SCAN domain containing 2 (ZSCAN2), transcript variant 3
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ZFP29; ZNF854 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC301144 representing NM_001007072.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGATGGCTGCAGACATCCCGAGAGTGACCACTCCGCTGAGCTCCTTGGTCCAGGTGCCTCAAGAGGAA GATAGACAGGAGGAGGAGGTCACCACCATGATCCTGGAGGATGACTCCTGGGTGCAAGAAGCTGTGCTG CAGGAGGATGGCCCTGAGTCTGAGCCCTTTCCCCAGAGTGCTGGCAAGGGCGGCCCCCAGGAGGAGGTG ACCAGGGGACCACAGGGTGCACTCGGCCGCCTCCGAGAGCTCTGCCGGCGCTGGCTGAGACCAGAGGTA CACACCAAGGAGCAGATGTTAACCATGCTGCCAAAGGAAATTCAGGCTTGGCTGCAAGAGCATCGGCCT GAAAGCAGTGAGGAGGCAGCGGCCCTGGTGGAAGACTTGACCCAGACCCTTCAGGACAGTGAAACAGCT TCCTGCGTACATGGCTGCCCTGTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001007072 |
Insert Size | 441 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001007072.1 |
RefSeq Size | 951 bp |
RefSeq ORF | 441 bp |
Locus ID | 54993 |
UniProt ID | Q7Z7L9 |
Protein Families | Transcription Factors |
MW | 16.3 kDa |
Gene Summary | The protein encoded by this gene contains several copies of zinc finger motif, which is commonly found in transcriptional regulatory proteins. Studies in mice show that this gene is expressed during embryonic development, and specifically in the testis in adult mice, suggesting that it may play a role in regulating genes in germ cells. Alternative splicing of this gene results in several transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) has a different 3' terminal exon compared to transcript variants 1 and 2, resulting in the shortest isoform (3) with a distinct C-terminus. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC211929 | ZSCAN2 (Myc-DDK-tagged)-Human zinc finger and SCAN domain containing 2 (ZSCAN2), transcript variant 3 |
CNY 1,200.00 |
|
RC211929L3 | Lenti ORF clone of Human zinc finger and SCAN domain containing 2 (ZSCAN2), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC211929L4 | Lenti ORF clone of Human zinc finger and SCAN domain containing 2 (ZSCAN2), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
RG211929 | ZSCAN2 (tGFP-tagged) - Human zinc finger and SCAN domain containing 2 (ZSCAN2), transcript variant 3 |
CNY 4,370.00 |