RASL10A (NM_001007279) Human Untagged Clone
CAT#: SC301211
RASL10A (untagged)-Human RAS-like, family 10, member A (RASL10A), transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | RRP22 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC301211 representing NM_001007279.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGGGGTAGCCTGCGGGTGGCCGTTCTAGGCGCCCCGGGCGTGGGCAAGACGGCCATCATCCGCCAG TTCCTGTTCGGTGACTACCCCGAGCGCCACCGGCCCACGGACGGGCCGCGCCTCTACCGACCCGCGGTG CTGCTCGACGGCGCCGTCTACGACTTGAGCATCCGCGACGGCGACGTCGCTGGCCCCGGCTCGAGCCCC GGGGGTCCGGAGGAGTGGCCAGACGCTAAGGACTGGAGCTTGCAGGACACGGACGCCTTCGTGCTCGTC TACGACATCTGCAGCCCGGACAGTTTCGACTACGTGAAGGCCCTGCGGCAGCGCATCGCGGAGACCAGG TAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001007279 |
Insert Size | 348 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001007279.1 |
RefSeq Size | 1813 bp |
RefSeq ORF | 348 bp |
Locus ID | 10633 |
MW | 12.5 kDa |
Gene Summary | Potent inhibitor of cellular proliferation.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) contains sequence that is intronic in variant 1. The intronic sequence includes an in-frame stop codon at its 5' end, resulting in an isoform (b) that is shorter at the C-terminus compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC208743 | RASL10A (Myc-DDK-tagged)-Human RAS-like, family 10, member A (RASL10A), transcript variant 2 |
CNY 1,200.00 |
|
RC208743L3 | Lenti ORF clone of Human RAS-like, family 10, member A (RASL10A), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC208743L4 | Lenti ORF clone of Human RAS-like, family 10, member A (RASL10A), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG208743 | RASL10A (tGFP-tagged) - Human RAS-like, family 10, member A (RASL10A), transcript variant 2 |
CNY 2,800.00 |
其它RASL10A产品