HCST (NM_001007469) Human Untagged Clone
CAT#: SC301216
HCST (untagged)-Human hematopoietic cell signal transducer (HCST), transcript variant 2
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DAP10; KAP10; PIK3AP |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC301216 representing NM_001007469.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGATCCATCTGGGTCACATCCTCTTCCTGCTTTTGCTCCCAGTGGCTGCAGCTCAGACGACTCCAGGA GAGAGATCATCACTCCCTGCCTTTTACCCTGGCACTTCAGGCTCTTGTTCCGGATGTGGGTCCCTCTCT CTGCCGCTCCTGGCAGGCCTCGTGGCTGCTGATGCGGTGGCATCGCTGCTCATCGTGGGGGCGGTGTTC CTGTGCGCACGCCCACGCCGCAGCCCCGCCCAAGATGGCAAAGTCTACATCAACATGCCAGGCAGGGGC TGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001007469 |
Insert Size | 279 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001007469.1 |
RefSeq Size | 521 bp |
RefSeq ORF | 279 bp |
Locus ID | 10870 |
UniProt ID | Q9UBK5 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Natural killer cell mediated cytotoxicity |
MW | 9.4 kDa |
Gene Summary | This gene encodes a transmembrane signaling adaptor that contains a YxxM motif in its cytoplasmic domain. The encoded protein may form part of the immune recognition receptor complex with the C-type lectin-like receptor NKG2D. As part of this receptor complex, this protein may activate phosphatidylinositol 3-kinase dependent signaling pathways through its intracytoplasmic YxxM motif. This receptor complex may have a role in cell survival and proliferation by activation of NK and T cell responses. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1, resulting in a shorter protein (isoform 2). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219253 | HCST (Myc-DDK-tagged)-Human hematopoietic cell signal transducer (HCST), transcript variant 2 |
CNY 1,200.00 |
|
RC219253L3 | Lenti ORF clone of Human hematopoietic cell signal transducer (HCST), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC219253L4 | Lenti ORF clone of Human hematopoietic cell signal transducer (HCST), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG219253 | HCST (tGFP-tagged) - Human hematopoietic cell signal transducer (HCST), transcript variant 2 |
CNY 2,800.00 |