STK16 (NM_001008910) Human Untagged Clone

CAT#: SC301388

STK16 (untagged)-Human serine/threonine kinase 16 (STK16), transcript variant 1



  "NM_001008910" in other vectors (6)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-STK16 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms hPSK; KRCT; MPSK; PKL12; PSK; TSF1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC301388 representing NM_001008910.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGCCACGCGCTGTGTGTCTGCTCTCGGGGAACTGTCATCATTGACAATAAGCGCTACCTCTTCATC
CAGAAACTGGGGGAGGGTGGGTTCAGCTATGTGGACCTAGTGGAAGGGTTACATGATGGACACTTCTAC
GCCCTGAAGCGAATCCTGTGTCACGAGCAGCAGGACCGGGAGGAGGCCCAGCGAGAAGCCGACATGCAT
CGCCTCTTCAATCACCCCAACATCCTTCGCCTCGTGGCTTACTGTCTGAGGGAACGGGGTGCTAAGCAT
GAGGCCTGGCTGCTGCTACCATTCTTCAAGAGAGGTACGCTGTGGAATGAGATAGAAAGGCTGAAGGAC
AAAGGCAACTTCCTGACCGAGGATCAAATCCTTTGGCTGCTGCTGGGGATCTGCAGAGGCCTTGAGGCC
ATTCATGCCAAGGGTTATGCCCACAGAGACTTGAAGCCCACCAATATATTGCTTGGAGATGAGGGGCAG
CCAGTTTTAATGGACTTGGGTTCCATGAATCAAGCATGCATCCATGTGGAGGGCTCCCGCCAGGCTCTG
ACCCTGCAGGACTGGGCAGCCCAGCGGTGCACCATCTCCTACCGAGCCCCAGAGCTCTTCTCTGTGCAG
AGTCACTGTGTCATCGATGAGCGGACTGATGTCTGGTCCCTAGGCTGCGTGCTATATGCCATGATGTTT
GGGGAAGGCCCTTATGACATGGTGTTCCAAAAGGGTGACAGTGTGGCCCTTGCTGTGCAGAACCAACTC
AGCATCCCACAAAGCCCCAGGCATTCTTCAGCATTGCGGCAGCTCCTGAACTCGATGATGACCGTGGAC
CCGCATCAGCGTCCTCACATTCCTCTCCTCCTCAGTCAGCTGGAGGCGCTGCAGCCCCCAGCTCCTGGC
CAACATACTACCCAAATCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001008910
Insert Size 918 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001008910.2
RefSeq Size 2903 bp
RefSeq ORF 918 bp
Locus ID 8576
UniProt ID O75716
Protein Families Druggable Genome, Protein Kinase
MW 34.7 kDa
Gene Summary Membrane-associated protein kinase that phosphorylates on serine and threonine residues. In vitro substrates include DRG1, ENO1 and EIF4EBP1. Also autophosphorylates. May be involved in secretory vesicle trafficking or intracellular signaling. May have a role in regulating stromal-epithelial interactions that occur during ductal morphogenesis in the mammary gland. May be involved in TGF-beta signaling. Able to autophosphorylate on Tyr residue; it is however unclear whether it has tyrosine-protein kinase toward other proteins.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the longest protein (isoform 1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...