Gemin 2 (GEMIN2) (NM_001009182) Human Untagged Clone

CAT#: SC301394

GEMIN2 (untagged)-Human survival of motor neuron protein interacting protein 1 (SIP1), transcript variant beta



  "NM_001009182" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
GEMIN2 mouse monoclonal antibody, clone OTI4C11 (formerly 4C11)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms SIP1; SIP1-delta
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001009182, the custom clone sequence may differ by one or more nucleotides
ATGCGCCGAGCGGAACTGGCTGGTTTGAAAACCATGGCGTGGGTACCAGCGGAGTCCGCA
GTGGAAGAGTTGATGCCTCGGCTATTGCCGGTAGAGCCTTGCGACTTGACGGAAGGTTTC
GATCCCTCGGTACCCCCGAGGACGCCTCAGGAATACCTGAGGCGGGTCCAGATCGAAGCA
GCTCAATGTCCAGATGTTGTGGTAGCTCAAATTGACCCAAAGAAGTTGAAAAGGAAGCAA
AGTGTGAATATTTCTCTTTCAGGATGCCAACCCGCCCCTGAAGGTTATTCCCCAACACTT
CAATGGCAACAGCAACAAGTGGCACAGTTTTCAACTGTTCGACAGAATGTGAACAAACAT
AGAAGTCACTGGAAATCACAACAGTTGGATAGTAATGTGACAATGCCAAAATCTGAAGAT
GAAGAAGGCTGGAAGAAATTTTGTCTGGGTGAAAAGTTATGTGCTGACGGGGCTGTTGGA
CCAGCCACAAATGAAAGTCCTGGAATAGATTATGTACAAGCAACAGTAACTAGTGTCTTG
GAATATCTGAGTAATTGGTTTGGAGAAAGAGACTTTACTCCAGAATTGGGAAGATGGCTT
TATGCTTTATTGGCTTGTCTTGAAAAGCCTTTGTTACCTGAGGCTCATTCACTGATTCGG
CAGCTTGCAAGAAGGTGCTCTGAAGTGAGGCTCTTAGTGGATAGCAAAGATGATGAGAGG
GTTCCTGCTTTGAATTTATTAATCTGCTTGGTTAGCAGGTATTTTGACCAACGTGATTTA
GCTGATGAGCCATCTTGA
Restriction Sites Please inquire     
ACCN NM_001009182
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001009182.1, NP_001009182.1
RefSeq Size 1323 bp
RefSeq ORF 798 bp
Locus ID 8487
UniProt ID O14893
Protein Families Druggable Genome, Stem cell - Pluripotency
Gene Summary This gene encodes one of the proteins found in the SMN complex, which consists of several gemin proteins and the protein known as the survival of motor neuron protein. The SMN complex is localized to a subnuclear compartment called gems (gemini of coiled bodies) and is required for assembly of spliceosomal snRNPs and for pre-mRNA splicing. This protein interacts directly with the survival of motor neuron protein and it is required for formation of the SMN complex. A knockout mouse targeting the mouse homolog of this gene exhibited disrupted snRNP assembly and motor neuron degeneration. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (beta) lacks an in-frame exon, compared to variant alpha. It encodes isoform beta which is shorter than isoform alpha.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...