United States
Germany
Japan
United Kingdom
China
IL32 (NM_001012635) Human Untagged Clone
CAT＃: SC301684
IL32 (untagged)-Human interleukin 32 (IL32), transcript variant 6
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | IL-32alpha; IL-32beta; IL-32delta; IL-32gamma; NK4; TAIF; TAIFa; TAIFb; TAIFc; TAIFd |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001012635, the custom clone sequence may differ by one or more nucleotides
ATGTGCTTCCCGAAGGTCCTCTCTGATGACATGAAGAAGCTGAAGGCCCGAATGGTGATG TCGAGCCTGGCAGAGCTGGAGGACGACTTCAAAGAGGGCTACCTGGAGACAGTGGCGGCT TATTATGAGGAGCAGCACCCAGAGCTCACTCCTCTACTTGAAAAAGAAAGAGATGGATTA CGGTGCCGAGGCAACAGATCCCCTGTCCCGGATGTTGAGGATCCCGCAACCGAGGAGCCT GGGGAGAGCTTTTGTGACAAGGTCATGAGATGGTTCCAGGCCATGCTGCAGCGGCTGCAG ACCTGGTGGCACGGGGTTCTGGCCTGGGTGAAGGAGAAGGTGGTGGCCCTGGTCCATGCA GTGCAGGCCCTCTGGAAACAGTTCCAGAGTTTCTGCTGCTCTCTGTCAGAGCTCTTCATG TCCTCTTTCCAGTCCTACGGAGCCCCACGGGGGGACAAGGAGGAGCTGACACCCCAGAAG TGCTCTGAACCCCAATCCTCAAAATGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001012635 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001012635.1, NP_001012653.1 |
| RefSeq Size | 892 bp |
| RefSeq ORF | 507 bp |
| Locus ID | 9235 |
| UniProt ID | P24001 |
| Protein Families | Secreted Protein |
| Gene Summary | This gene encodes a member of the cytokine family. The protein contains a tyrosine sulfation site, 3 potential N-myristoylation sites, multiple putative phosphorylation sites, and an RGD cell-attachment sequence. Expression of this protein is increased after the activation of T-cells by mitogens or the activation of NK cells by IL-2. This protein induces the production of TNFalpha from macrophage cells. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (6) differs in the 5' UTR and lacks an alternate in-frame exon within the coding region, compared to variant 1, resulting in a shorter protein (isoform C). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC222815 | IL32 (Myc-DDK-tagged)-Human interleukin 32 (IL32), transcript variant 6 |
CNY 2,400.00 |
|
| RC222815L3 | Lenti-ORF clone of IL32 (Myc-DDK-tagged)-Human interleukin 32 (IL32), transcript variant 6 |
CNY 5,890.00 |
|
| RC222815L4 | Lenti-ORF clone of IL32 (mGFP-tagged)-Human interleukin 32 (IL32), transcript variant 6 |
CNY 5,890.00 |
|
| RG222815 | IL32 (tGFP-tagged) - Human interleukin 32 (IL32), transcript variant 6 |
CNY 4,370.00 |
