United States
Germany
Japan
United Kingdom
China
CD239 (BCAM) (NM_001013257) Human Untagged Clone
CAT＃: SC301769
BCAM (untagged)-Human basal cell adhesion molecule (Lutheran blood group) (BCAM), transcript variant 2
CNY 9,500.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | AU; CD239; LU; MSK19 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001013257, the custom clone sequence may differ by one or more nucleotides
ATGGAGCCCCCGGACGCACCGGCCCAGGCGCGCGGGGCCCCGCGGCTGCTGTTGCTCGCA GTCCTGCTGGCGGCGCACCCAGATGCCCAGGCGGAGGTGCGCTTGTCTGTACCCCCGCTG GTGGAGGTGATGCGAGGAAAGTCTGTCATTCTGGACTGCACCCCTACGGGAACCCACGAC CATTATATGCTGGAATGGTTCCTTACCGACCGCTCGGGAGCTCGCCCCCGCCTAGCCTCG GCTGAGATGCAGGGCTCTGAGCTCCAGGTCACAATGCACGACACCCGGGGCCGCAGTCCC CCATACCAGCTGGACTCCCAGGGGCGCCTGGTGCTGGCTGAGGCCCAGGTGGGCGACGAG CGAGACTACGTGTGCGTGGTGAGGGCAGGGGCGGCAGGCACTGCTGAGGCCACTGCGCGG CTCAACGTGTTTGCAAAGCCAGAGGCCACTGAGGTCTCCCCCAACAAAGGGACACTGTCT GTGATGGAGGACTCTGCCCAGGAGATCGCCACCTGCAACAGCCGGAACGGGAACCCGGCC CCCAAGATCACGTGGTATCGCAACGGGCAGCGCCTGGAGGTGCCCGTAGAGATGAACCCA GAGGGCTACATGACCAGCCGCACGGTCCGGGAGGCCTCGGGCCTGCTCTCCCTCACCAGC ACCCTCTACCTGCGGCTCCGCAAGGATGACCGAGACGCCAGCTTCCACTGCGCCGCCCAC TACAGCCTGCCCGAGGGCCGCCACGGCCGCCTGGACAGCCCCACCTTCCACCTCACCCTG CACTATCCCACGGAGCACGTGCAGTTCTGGGTGGGCAGCCCGTCCACCCCAGCAGGCTGG GTACGCGAGGGTGACACTGTCCAGCTGCTCTGCCGGGGGGACGGCAGCCCCAGCCCGGAG TATACGCTTTTCCGCCTTCAGGATGAGCAGGAGGAAGTGCTGAATGTGAATCTCGAGGGG AACTTGACCCTGGAGGGAGTGACCCGGGGCCAGAGCGGGACCTATGGCTGCAGAGTGGAG GATTACGACGCGGCAGATGACGTGCAGCTCTCCAAGACGCTGGAGCTGCGCGTGGCCTAT CTGGACCCCCTGGAGCTCAGCGAGGGGAAGGTGCTTTCCTTACCTCTAAACAGCAGTGCA GTCGTGAACTGCTCCGTGCACGGCCTGCCCACCCCTGCCCTACGCTGGACCAAGGACTCC ACTCCCCTGGGCGATGGCCCCATGCTGTCGCTCAGTTCTATCACCTTCGATTCCAATGGC ACCTACGTATGTGAGGCCTCCCTGCCCACAGTCCCGGTCCTCAGCCGCACCCAGAACTTC ACGCTGCTGGTCCAAGGCTCGCCAGAGCTAAAGACAGCGGAAATAGAGCCCAAGGCAGAT GGCAGCTGGAGGGAAGGAGACGAAGTCACACTCATCTGCTCTGCCCGCGGCCATCCAGAC CCCAAACTCAGCTGGAGCCAATTGGGGGGCAGCCCCGCAGAGCCAATCCCCGGACGGCAG GGTTGGGTGAGCAGCTCTCTGACCCTGAAAGTGACCAGCGCCCTGAGCCGCGATGGCATC TCCTGTGAAGCCTCCAACCCCCACGGGAACAAGCGCCATGTCTTCCACTTCGGCACCGTG AGCCCCCAGACCTCCCAGGCTGGAGTGGCCGTCATGGCCGTGGCCGTCAGCGTGGGCCTC CTGCTCCTCGTCGTTGCTGTCTTCTACTGCGTGAGACGCAAAGGGGGCCCCTGCTGCCGC CAGCGGCGGGAGAAGGGGGCTCCGTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001013257 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001013257.1, NP_001013275.1 |
| RefSeq Size | 2434 bp |
| RefSeq ORF | 1767 bp |
| Locus ID | 4059 |
| UniProt ID | P50895 |
| Protein Families | Druggable Genome, Transmembrane |
| Gene Summary | This gene encodes Lutheran blood group glycoprotein, a member of the immunoglobulin superfamily and a receptor for the extracellular matrix protein, laminin. The protein contains five extracellular immunoglobulin domains, a single transmembrane domain, and a short C-terminal cytoplasmic tail. This protein may play a role in epithelial cell cancer and in vaso-occlusion of red blood cells in sickle cell disease. Polymorphisms in this gene define some of the antigens in the Lutheran system and also the Auberger system. Inactivating variants of this gene result in the recessive Lutheran null phenotype, Lu(a-b-), of the Lutheran blood group. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012] Transcript Variant: This variant (2) includes an additional segment in its 3' coding region, which results in an early stop codon, compared to variant 1. The encoded isoform (2) is shorter at the C-terminus, compared to isoform 1. The full-length nature of this variant is supported by data in PMIDs 8781446 and 9192786. Sequence Note: This RefSeq record represents the LU*0010101 allele. This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CCDS Note: This CCDS ID represents the BCAM transcript variant described in PMIDs 8781446 and 9192786. It encodes the C-terminally truncated 78 kDa isoform described in PMIDs 3810828 and 7777537. The transcript is a candidate for nonsense-mediated mRNA decay (NMD), but the protein is represented because this is the only currently available transcript variant that can encode the 78 kDa isoform. This isoform was detected by immunoblotting in PMID:3810828, and the authors of PMID:7777537 indicate that this isoform was not detected when C-terminal antibodies were used, but it was when antibodies from the region in common with the 85 kDa isoform (CCDS12644.1 representation) were used, thereby suggesting that this C-terminally truncated isoform is valid. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC215230 | BCAM (Myc-DDK-tagged)-Human basal cell adhesion molecule (Lutheran blood group) (BCAM), transcript variant 2 |
CNY 4,376.00 |
|
| RC215230L1 | Lenti-ORF clone of BCAM (Myc-DDK-tagged)-Human basal cell adhesion molecule (Lutheran blood group) (BCAM), transcript variant 2 |
CNY 6,776.00 |
|
| RC215230L2 | Lenti-ORF clone of BCAM (mGFP-tagged)-Human basal cell adhesion molecule (Lutheran blood group) (BCAM), transcript variant 2 |
CNY 6,460.00 |
|
| RC215230L3 | Lenti-ORF clone of BCAM (Myc-DDK-tagged)-Human basal cell adhesion molecule (Lutheran blood group) (BCAM), transcript variant 2 |
CNY 6,460.00 |
|
| RC215230L4 | Lenti-ORF clone of BCAM (mGFP-tagged)-Human basal cell adhesion molecule (Lutheran blood group) (BCAM), transcript variant 2 |
CNY 6,460.00 |
|
| RG215230 | BCAM (tGFP-tagged) - Human basal cell adhesion molecule (Lutheran blood group) (BCAM), transcript variant 2 |
CNY 5,040.00 |
