PAGE5 (NM_001013435) Human Untagged Clone
CAT#: SC301783
PAGE5 (untagged)-Human P antigen family, member 5 (prostate associated) (PAGE5), transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CT16; CT16.1; CT16.2; GAGEE1; PAGE-5 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC301783 representing NM_001013435.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAGTGAGCATGTAACAAGATCCCAATCCTCAGAAAGAGGAAATGACCAAGAGTCTTCCCAGCCAGTT GGACCTGTGATTGTCCAGCAGCCCACTGAGGAAAAACGTCAAGAAGAGGAACCACCAACTGATAATCAG GGTATTGCACCTAGTGGGGAGATCAAAAATGAAGGAGCACCTGCTGTTCAAGGGACTGATGTGGAAGCT TTTCAACAGGAACTGGCTCTGCTTAAGATAGAGGATGCACCTGGAGATGGTCCTGATGTCAGGGAGGGG ACTCTGCCCACTTTTGATCCCACTAAAGTGCTGGAAGCAGGTGAAGGGCAACTATAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001013435 |
Insert Size | 333 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001013435.2 |
RefSeq Size | 572 bp |
RefSeq ORF | 333 bp |
Locus ID | 90737 |
UniProt ID | Q96GU1 |
MW | 11.8 kDa |
Gene Summary | This gene is a member of family of proteins that are expressed in a variety of tumors and in some fetal and reproductive tissues. The encoded protein may protect cells from programmed cell death. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found. [provided by RefSeq, Jan 2015] Transcript Variant: This variant (2) uses an alternate splice site in the 5' region and initiates translation from a downstream start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC211048 | PAGE5 (Myc-DDK-tagged)-Human P antigen family, member 5 (prostate associated) (PAGE5), transcript variant 2 |
CNY 1,200.00 |
|
RC211048L3 | Lenti ORF clone of Human P antigen family, member 5 (prostate associated) (PAGE5), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC211048L4 | Lenti ORF clone of Human P antigen family, member 5 (prostate associated) (PAGE5), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG211048 | PAGE5 (tGFP-tagged) - Human P antigen family, member 5 (prostate associated) (PAGE5), transcript variant 2 |
CNY 2,800.00 |