Epigen (EPGN) (NM_001013442) Human Untagged Clone
CAT#: SC301789
EPGN (untagged)-Human epithelial mitogen homolog (mouse) (EPGN)
CNY 1,320.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ALGV3072; EPG; epigen; PRO9904 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC301789 representing NM_001013442.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCTTTGGGAGTTCCAATATCAGTCTATCTTTTATTCAACGCAATGACAGCACTGACCGAAGAGGCA GCCGTGACTGTAACACCTCCAATCACAGCCCAGCAAGCTGACAACATAGAAGGACCCATAGCCTTGAAG TTCTCACACCTTTGCCTGGAAGATCATAACAGTTACTGCATCAACGGTGCTTGTGCATTCCACCATGAG CTAGAGAAAGCCATCTGCAGGTGTTTTACTGGTTATACTGGAGAAAGGTGTGAGCACTTGACTTTAACT TCATATGCTGTGGATTCTTATGAAAAATACATTGCAATTGGGATTGGTGTTGGATTACTATTAAGTGGT TTTCTTGTTATTTTTTACTGCTATATAAGAAAGAGGTATGAAAAAGACAAAATATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001013442 |
Insert Size | 402 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001013442.1 |
RefSeq Size | 847 bp |
RefSeq ORF | 402 bp |
Locus ID | 255324 |
Protein Families | Transmembrane |
MW | 14.8 kDa |
Gene Summary | The protein encoded by this gene is a member of the epidermal growth factor family. Members of this family are ligands for the epidermal growth factor receptor and play a role in cell survival, proliferation and migration. This protein has been reported to have high mitogenic activity but low affinity for its receptor. Expression of this transcript and protein have been reported in cancer specimens of the breast, bladder, and prostate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214501 | EPGN (Myc-DDK-tagged)-Human epithelial mitogen homolog (mouse) (EPGN) |
CNY 1,200.00 |
|
RC214501L1 | Lenti ORF clone of Human epithelial mitogen homolog (mouse) (EPGN), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC214501L2 | Lenti ORF clone of Human epithelial mitogen homolog (mouse) (EPGN), mGFP tagged |
CNY 5,890.00 |
|
RC214501L3 | Lenti ORF clone of Human epithelial mitogen homolog (mouse) (EPGN), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC214501L4 | Lenti ORF clone of Human epithelial mitogen homolog (mouse) (EPGN), mGFP tagged |
CNY 3,600.00 |
|
RG214501 | EPGN (tGFP-tagged) - Human epithelial mitogen homolog (mouse) (EPGN) |
CNY 4,370.00 |