IL31 (NM_001014336) Human Untagged Clone

CAT#: SC301922

IL31 (untagged)-Human interleukin 31 (IL31)



  "NM_001014336" in other vectors (6)

CNY 3,990.00


货期*
2周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Biotinylated Anti-Human IL-31 Rabbit Polyclonal Antibody
    • 50 ug

CNY 3,150.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms IL-31
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_001014336 edited
ATGGCCTCTCACTCAGGCCCCTCGACGTCTGTGCTCTTTCTGTTCTGCTGCCTGGGAGGC
TGGCTGGCCTCCCACACGTTGCCCGTCCGTTTACTACGACCAAGTGATGATGTACAGAAA
ATAGTCGAGGAATTACAGTCCCTCTCGAAGATGCTTTTGAAAGATGTGGAGGAAGAGAAG
GGCGTGCTCGTGTCCCAGAATTACACGCTGCCGTGTCTCAGCCCTGACGCCCAGCCGCCA
AACAACATCCACAGCCCAGCCATCCGGGCATATCTCAAGACAATCAGACAGCTAGACAAC
AAATCTGTTATTGATGAGATCATAGAGCACCTCGACAAACTCATATTTCAAGATGCACCA
GAAACAAACATTTCTGTGCCAACAGACACCCATGAATGTAAACGCTTCATCCTGACTATT
TCTCAACAGTTTTCAGAGTGCATGGACCTCGCACTAAAATCATTGACCTCTGGAGCCCAA
CAGGCCACCACTTAA
Restriction Sites Please inquire     
ACCN NM_001014336
Insert Size 500 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001014336.1, NP_001014358.1
RefSeq Size 904 bp
RefSeq ORF 495 bp
Locus ID 386653
UniProt ID Q6EBC2
Protein Families Secreted Protein, Transmembrane
Gene Summary IL31, which is made principally by activated Th2-type T cells, interacts with a heterodimeric receptor consisting of IL31RA (MIM 609510) and OSMR (MIM 601743) that is constitutively expressed on epithelial cells and keratinocytes. IL31 may be involved in the promotion of allergic skin disorders and in regulating other allergic diseases, such as asthma (Dillon et al., 2004 [PubMed 15184896]).[supplied by OMIM, Mar 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...