mu Crystallin (CRYM) (NM_001014444) Human Untagged Clone
CAT#: SC301942
CRYM (untagged)-Human crystallin, mu (CRYM), transcript variant 2
CNY 6,270.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DFNA40; THBP |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC301942 representing NM_001014444.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCAGCCCGTGCGCACCGTGGTGCCGGTGACCAAGCACAGGGGCTACCTGGGGGTCATGCCCGCCTAC AGTGCTGCAGAGGATGCACTGACCACCAAGTTGGTCACCTTCTACGAGGACCGCGGCATCACCTCGGTC GTCCCTTCCCACCAGGCTACTGTGCTACTCTTTGAGCCCAGCAATGGCACCCTGCTGGCGGTCATGGAT GGAAATGTCATAACTGCAAAGAGAACAGCTGCAGTTTCTGCCATTGCCACCAAGTTTCTGAAACCTCCC AGCAGTGAAGTGCTGTGCATCCTTGGGGCTGGGGTCCAGGCCTACAGCCATTATGAGATCTTCACAGAG CAGTTCTCCTTTAAGGAGGTGAGGATATGGAACCGCACCAAAGAAAATGCAGAGAAGTTTGCAGACACA GTGCAAGGAGAGGTACGGGTCTGTTCTTCGGTCCAGGAGGCTGTGGCAGGTGCAGATGTGATCATCACA GTCACCCTGGCAACAGAGCCCATTTTGTTTGGTGAATGGGTGAAGCCAGGGGCTCACATCAATGCTGTT GGAGCCAGCAGACCTGACTGGAGAGAACTGGATGATGAGCTCATGAAAGAAGCTGTGCTGTACGTGGAT TCCCAGGAGGCTGCCCTGAAGGAGTCTGGAGATGTCCTGCTGTCAGGGGCCGAGATCTTTGCTGAGCTG GGAGAAGTGATTAAGGGAGTGAAACCAGCCCACTGTGAGAAGACCACCGTGTTCAAGTCTTTGGGAATG GCAGTGGAAGACACAGTTGCAGCCAAACTCATCTATGATTCCTGGTCATCTGGTAAATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001014444 |
Insert Size | 819 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001014444.2 |
RefSeq Size | 1232 bp |
RefSeq ORF | 819 bp |
Locus ID | 1428 |
MW | 29.4 kDa |
Gene Summary | Crystallins are separated into two classes: taxon-specific and ubiquitous. The former class is also called phylogenetically-restricted crystallins. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. This gene encodes a taxon-specific crystallin protein that binds NADPH and has sequence similarity to bacterial ornithine cyclodeaminases. The encoded protein does not perform a structural role in lens tissue, and instead it binds thyroid hormone for possible regulatory or developmental roles. Mutations in this gene have been associated with autosomal dominant non-syndromic deafness. [provided by RefSeq, Sep 2014] Transcript Variant: This variant (2) differs in the 5' UTR and lacks an in-frame portion of the 5' coding region, compared to variant 1. The resulting isoform (2) has a shorter N-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC205374 | CRYM (Myc-DDK-tagged)-Human crystallin, mu (CRYM), transcript variant 2 |
CNY 2,400.00 |
|
RC205374L3 | Lenti ORF clone of Human crystallin, mu (CRYM), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC205374L4 | Lenti ORF clone of Human crystallin, mu (CRYM), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG205374 | CRYM (tGFP-tagged) - Human crystallin, mu (CRYM), transcript variant 2 |
CNY 4,370.00 |
其它mu Crystallin产品