TSC22D3 (NM_001015881) Human Untagged Clone

CAT#: SC302006

TSC22D3 (untagged)-Human TSC22 domain family, member 3 (TSC22D3), transcript variant 3



  "NM_001015881" in other vectors (4)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TSC22D3 mouse monoclonal antibody, clone OTI1F11 (formerly 1F11)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DIP; DSIPI; GILZ; TSC-22R
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001015881, the custom clone sequence may differ by one or more nucleotides
ATGGATCTGGTGAAGAATCATCTGATGTATGCTGTGAGAGAGGAGGTGGAGATCCTGAAG
GAGCAGATCCGAGAGCTGGTGGAGAAGAACTCCCAGCTAGAGCGTGAGAACACCCTGTTG
AAGACCCTGGCAAGCCCAGAGCAGCTGGAGAAGTTCCAGTCCTGTCTGAGCCCTGAAGAG
CCAGCTCCCGAATCCCCACAAGTGCCCGAGGCCCCTGGTGGTTCTGCGGTGTAA
Restriction Sites Please inquire     
ACCN NM_001015881
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001015881.1, NP_001015881.1
RefSeq Size 1781 bp
RefSeq ORF 234 bp
Locus ID 1831
UniProt ID Q99576
Protein Families Transcription Factors
Gene Summary This gene encodes the anti-inflammatory protein glucocorticoid (GC)-induced leucine zipper. Expression of this gene stimulated by glucocorticoids and interleukin 10 and it appears to play a key role in the anti-inflammatory and immunosuppressive effects of this steroid. This protein has also been shown to inhibit pro-inflammatory molecules including nuclear factor κB. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Transcript Variant: This variant (3) differs in the 5' UTR and the 5' coding region, compared to variant 1. The resulting isoform (3) has a shorter N-terminus when compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...