TSC22D3 (NM_001015881) Human Untagged Clone
CAT#: SC302006
TSC22D3 (untagged)-Human TSC22 domain family, member 3 (TSC22D3), transcript variant 3
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DIP; DSIPI; GILZ; TSC-22R |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001015881, the custom clone sequence may differ by one or more nucleotides
ATGGATCTGGTGAAGAATCATCTGATGTATGCTGTGAGAGAGGAGGTGGAGATCCTGAAG GAGCAGATCCGAGAGCTGGTGGAGAAGAACTCCCAGCTAGAGCGTGAGAACACCCTGTTG AAGACCCTGGCAAGCCCAGAGCAGCTGGAGAAGTTCCAGTCCTGTCTGAGCCCTGAAGAG CCAGCTCCCGAATCCCCACAAGTGCCCGAGGCCCCTGGTGGTTCTGCGGTGTAA |
Restriction Sites | Please inquire |
ACCN | NM_001015881 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001015881.1, NP_001015881.1 |
RefSeq Size | 1781 bp |
RefSeq ORF | 234 bp |
Locus ID | 1831 |
UniProt ID | Q99576 |
Protein Families | Transcription Factors |
Gene Summary | This gene encodes the anti-inflammatory protein glucocorticoid (GC)-induced leucine zipper. Expression of this gene stimulated by glucocorticoids and interleukin 10 and it appears to play a key role in the anti-inflammatory and immunosuppressive effects of this steroid. This protein has also been shown to inhibit pro-inflammatory molecules including nuclear factor κB. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016] Transcript Variant: This variant (3) differs in the 5' UTR and the 5' coding region, compared to variant 1. The resulting isoform (3) has a shorter N-terminus when compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214246 | TSC22D3 (Myc-DDK-tagged)-Human TSC22 domain family, member 3 (TSC22D3), transcript variant 3 |
CNY 3,990.00 |
|
RC214246L3 | Lenti-ORF clone of TSC22D3 (Myc-DDK-tagged)-Human TSC22 domain family, member 3 (TSC22D3), transcript variant 3 |
CNY 5,890.00 |
|
RC214246L4 | Lenti-ORF clone of TSC22D3 (mGFP-tagged)-Human TSC22 domain family, member 3 (TSC22D3), transcript variant 3 |
CNY 5,890.00 |
|
RG214246 | TSC22D3 (tGFP-tagged) - Human TSC22 domain family, member 3 (TSC22D3), transcript variant 3 |
CNY 4,370.00 |
其它TSC22D3产品