TAF9 (NM_001015892) Human Untagged Clone
CAT#: SC302014
TAF9 (untagged)-Human TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa (TAF9), transcript variant 4
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | MGC:5067; STAF31/32; TAF2G; TAFII-31; TAFII-32; TAFII31; TAFII32; TAFIID32 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC302014 representing NM_001015892.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGAGTCTGGCAAGACGGCTTCTCCCAAGAGCATGCCGAAAGATGCACAGATGATGGCACAAATCCTG AAGGATATGGGGATTACAGAATATGAGCCAAGAGTTATAAATCAGATGTTGGAGTTTGCCTTCCGATAT GTGACCACAATTCTAGATGATGCAAAAATTTATTCAAGCCATGCTAAGAAAGCTACTGTTGATGCAGAT GATGTGCGATTGGCAATCCAGTGCCGCGCTGATCAGTCTTTTACCTCTCCTCCCCCAAGAGATTTTTTA TTAGATATTGCAAGGCAAAGAAATCAAACCCCTTTGCCATTGATCAAGCCATATTCAGGTCCTAGGTTG CCACCTGATAGATACTGCTTAACAGCTCCAAACTATAGGCTGAAATCTTTACAGAAAAAGGCATCAACT TCTGCGGGAAGAATAACAGTCCCGCGGTTAAGTGTTGGTTCAGTTACTAGCAGACCAAGTACTCCCACA CTAGGCACACCAACCCCACAGACCATGTCTGTTTCAACTAAAGTAGGGACTCCCATGTCCCTCACAGGT CAAAGGTTTACAGTACAGATGCCTACTTCTCAGTCTCCAGCTGTAAAAGCTTCAATTCCTGCAACCTCA GCAGTTCAGAATGTTCTGATTAATCCATCATTAATCGGGTCCAAAAACATTCTTATTACCACTAATATG ATGTCATCACAAAATACTGCCAATGAATCATCAAATGCATTGAAAAGAAAACGTGAAGATGATGATGAT GACGATGATGATGATGATGACTATGATAATCTGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001015892 |
Insert Size | 795 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001015892.1 |
RefSeq Size | 1482 bp |
RefSeq ORF | 795 bp |
Locus ID | 6880 |
UniProt ID | Q16594 |
Protein Families | Transcription Factors |
Protein Pathways | Basal transcription factors |
MW | 29 kDa |
Gene Summary | Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the smaller subunits of TFIID that binds to the basal transcription factor GTF2B as well as to several transcriptional activators such as p53 and VP16. In human, TAF9 and AK6 (GeneID: 102157402) are two distinct genes that share 5' exons. A similar but distinct gene (TAF9L) has been found on the X chromosome and a pseudogene has been identified on chromosome 19. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013] Transcript Variant: This variant (4) represents the longer transcript. Both variants 4 and 1 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214833 | TAF9 (Myc-DDK-tagged)-Human TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa (TAF9), transcript variant 4 |
CNY 3,600.00 |
|
RC214833L3 | Lenti ORF clone of Human TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa (TAF9), transcript variant 4, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC214833L4 | Lenti ORF clone of Human TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa (TAF9), transcript variant 4, mGFP tagged |
CNY 5,890.00 |
|
RG214833 | TAF9 (tGFP-tagged) - Human TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa (TAF9), transcript variant 4 |
CNY 5,200.00 |