BRCC36 (BRCC3) (NM_001018055) Human Untagged Clone

CAT#: SC302145

BRCC3 (untagged)-Human BRCA1/BRCA2-containing complex, subunit 3 (BRCC3), transcript variant 2



  "NM_001018055" in other vectors (6)

CNY 2,400.00

CNY 6,270.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
BRCC3 mouse monoclonal antibody,clone OTI6G7
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BRCC36; C6.1A; CXorf53
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_001018055 edited
ATGGCGGTGCAGGTGGTGCAGGCGGTGCAGGCGGTTCATCTCGAGTCTGACGCTTTCCTC
GTTTGTCTCAACCACGCTCTGAGCACAGAGAAGGAGGAAGTAATGGGGCTGTGCATAGGG
GAGTTGAACGATGATACAAGGAGTGACTCCAAATTTGCATATACTGGAACTGAAATGCGC
ACAGTTGCTGAAAAGGTTGATGCCGTCAGAATTGTTCACATTCATTCTGTCATCATCTTA
CGACGTTCTGATAAGAGGAAGGACCGAGTAGAAATTTCTCCAGAGCAGCTGTCTGCAGCT
TCAACAGAGGCAGAGAGGTTGGCTGAACTGACAGGCCGCCCCATGAGAGTTGTGGGCTGG
TATCATTCCCATCCTCATATAACTGTTTGGCCTTCACATGTTGATGTTCGCACACAAGCC
ATGTACCAGATGATGGATCAAGGCTTTGTAGGACTTATTTTTTCCTGTTTCATAGAAGAT
AAGAACACAAAGACTGGCCGGGTACTCTACACTTGCTTCCAATCCATACAGGCCCAAAAG
AGTTCAGAGTATGAGAGAATCGAAATCCCAATCCATATTGTACCTCATGTCACTATCGGG
AAAGTGTGCCTTGAATCAGCAGTAGAGCTGCCCAAGATCCTGTGCCAGGAGGAGCAGGAT
GCGTATAGGAGGATCCACAGCCTTACACATCTGGACTCAGTAACCAAGATCCATAATGGC
TCAGTGTTTACCAAGAATCTGTGCAGTCAGATGTCGGCAGTCAGCGGGCCTCTCCTACAG
TGGTTGGAGGACAGACTGGAGCAAAACCAACAGCATTTGCAGGAATTACAACAAGAAAAG
GAAGAGCTTATGCAAGAACTTTCTTCTCTAGAATAA
Restriction Sites NotI-NotI     
ACCN NM_001018055
Insert Size 2800 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001018055.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001018055.1, NP_001018065.1
RefSeq Size 2839 bp
RefSeq ORF 876 bp
Locus ID 79184
UniProt ID P46736
Protein Families Druggable Genome, Protease
Gene Summary This gene encodes a subunit of the BRCA1-BRCA2-containing complex (BRCC), which is an E3 ubiquitin ligase. This complex plays a role in the DNA damage response, where it is responsible for the stable accumulation of BRCA1 at DNA break sites. The component encoded by this gene can specifically cleave Lys 63-linked polyubiquitin chains, and it regulates the abundance of these polyubiquitin chains in chromatin. The loss of this gene results in abnormal angiogenesis and is associated with syndromic moyamoya, a cerebrovascular angiopathy. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 5. [provided by RefSeq, Jun 2011]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the central coding region, compared to variant 1, resulting in an isoform (2) that is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...