NME2 (NME1-NME2) (NM_001018136) Human Untagged Clone
CAT#: SC302195
NME1 (untagged)-Human NME1-NME2 readthrough (NME1-NME2), transcript variant 1
CNY 6,270.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | NM23-LV; NMELV |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001018136, the custom clone sequence may differ by one or more nucleotides
ATGGCCAACTGTGAGCGTACCTTCATTGCGATCAAACCAGATGGGGTCCAGCGGGGTCTT GTGGGAGAGATTATCAAGCGTTTTGAGCAGAAAGGATTCCGCCTTGTTGGTCTGAAATTC ATGCAAGCTTCCGAAGATCTTCTCAAGGAACACTACGTTGACCTGAAGGACCGTCCATTC TTTGCCGGCCTGGTGAAATACATGCACTCAGGGCCGGTAGTTGCCATGGTCTGGGAGGGG CTGAATGTGGTGAAGACGGGCCGAGTCATGCTCGGGGAGACCAACCCTGCAGACTCCAAG CCTGGGACCATCCGTGGAGACTTCTGCATACAAGTTGGCAGGACCATGGCCAACCTGGAG CGCACCTTCATCGCCATCAAGCCGGACGGCGTGCAGCGCGGCCTGGTGGGCGAGATCATC AAGCGCTTCGAGCAGAAGGGATTCCGCCTCGTGGCCATGAAGTTCCTCCGGGCCTCTGAA GAACACCTGAAGCAGCACTACATTGACCTGAAAGACCGACCATTCTTCCCTGGGCTGGTG AAGTACATGAACTCAGGGCCGGTTGTGGCCATGGTCTGGGAGGGGCTGAACGTGGTGAAG ACAGGCCGAGTGATGCTTGGGGAGACCAATCCAGCAGATTCAAAGCCAGGCACCATTCGT GGGGACTTCTGCATTCAGGTTGGCAGGAACATCATTCATGGCAGTGATTCAGTAAAAAGT GCTGAAAAAGAAATCAGCCTATGGTTTAAGCCTGAAGAACTGGTTGACTACAAGTCTTGT GCTCATGACTGGGTCTATGAATAA |
Restriction Sites | Please inquire |
ACCN | NM_001018136 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001018136.1, NP_001018146.1 |
RefSeq Size | 1107 bp |
RefSeq ORF | 1092 bp |
Locus ID | 654364 |
UniProt ID | P22392 |
Protein Families | Druggable Genome, Stem cell - Pluripotency |
Protein Pathways | Metabolic pathways, Purine metabolism, Pyrimidine metabolism |
Gene Summary | This locus represents naturally occurring read-through transcription between the neighboring NME1 and NME2 genes. The significance of this read-through transcription and the function of the resulting protein product have not yet been determined. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2010] Transcript Variant: This variant (1) represents the shorter transcript but encodes the supported protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC210662 | NME1 (Myc-DDK-tagged)-Human NME1-NME2 readthrough (NME1-NME2), transcript variant 1 |
CNY 1,200.00 |
|
RC210662L3 | Lenti-ORF clone of NME1 (Myc-DDK-tagged)-Human NME1-NME2 readthrough (NME1-NME2), transcript variant 1 |
CNY 5,890.00 |
|
RC210662L4 | Lenti-ORF clone of NME1 (mGFP-tagged)-Human NME1-NME2 readthrough (NME1-NME2), transcript variant 1 |
CNY 5,890.00 |
|
RG210662 | NME1 (tGFP-tagged) - Human NME1-NME2 readthrough (NME1-NME2), transcript variant 1 |
CNY 2,800.00 |
|
SC321018 | NME1 (untagged)-Human NME1-NME2 readthrough (NME1-NME2), transcript variant 1 |
CNY 3,656.00 |
其它NME1-NME2产品