United States
Germany
Japan
United Kingdom
China
c Maf (MAF) (NM_001031804) Human Untagged Clone
CAT＃: SC302598
MAF (untagged)-Human v-maf musculoaponeurotic fibrosarcoma oncogene homolog (avian) (MAF), transcript variant 2
CNY 7,220.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | AYGRP; c-MAF; CCA4; CTRCT21 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001031804, the custom clone sequence may differ by one or more nucleotides
ATGGCATCAGAACTGGCAATGAGCAACTCCGACCTGCCCACCAGTCCCCTGGCCATGGAA TATGTTAATGACTTCGATCTGATGAAGTTTGAAGTGAAAAAGGAACCGGTGGAGACCGAC CGCATCATCAGCCAGTGCGGCCGTCTCATCGCCGGGGGCTCGCTGTCCTCCACCCCCATG AGCACGCCGTGCAGCTCGGTGCCCCCTTCCCCCAGCTTCTCGGCGCCCAGCCCGGGCTCG GGCAGCGAGCAGAAGGCGCACCTGGAAGACTACTACTGGATGACCGGCTACCCGCAGCAG CTGAACCCCGAGGCGCTGGGCTTCAGCCCCGAGGACGCGGTCGAGGCGCTCATCAGCAAC AGCCACCAGCTCCAGGGCGGCTTCGATGGCTACGCGCGCGGGGCGCAGCAGCTGGCCGCG GCGGCCGGGGCCGGTGCCGGCGCCTCCTTGGGCGGCAGCGGCGAGGAGATGGGCCCCGCC GCCGCCGTGGTGTCCGCCGTGATCGCCGCGGCCGCCGCGCAGAGCGGCGCGGGCCCGCAC TACCACCACCACCACCACCACGCCGCCGGCCACCACCACCACCCGACGGCCGGCGCGCCC GGCGCCGCGGGCAGCGCGGCCGCCTCGGCCGGTGGCGCTGGGGGCGCGGGCGGCGGTGGC CCGGCCAGCGCTGGGGGCGGCGGCGGCGGCGGCGGCGGCGGAGGCGGCGGGGGCGCGGCG GGGGCGGGGGGCGCCCTGCACCCGCACCACGCCGCCGGCGGCCTGCACTTCGACGACCGC TTCTCCGACGAGCAGCTGGTGACCATGTCTGTGCGCGAGCTGAACCGGCAGCTGCGCGGG GTCAGCAAGGAGGAGGTGATCCGGCTGAAGCAGAAGAGGCGGACCCTGAAAAACCGCGGC TATGCCCAGTCCTGCCGCTTCAAGAGGGTGCAGCAGAGACACGTCCTGGAGTCGGAGAAG AACCAGCTGCTGCAGCAAGTCGACCACCTCAAGCAGGAGATCTCCAGGCTGGTGCGCGAG AGGGACGCGTACAAGGAGAAATACGAGAAGTTGGTGAGCAGCGGCTTCCGAGAAAACGGC TCGAGCAGCGACAACCCGTCCTCTCCCGAGTTTTTCATGTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001031804 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001031804.1, NP_001026974.1 |
| RefSeq Size | 6392 bp |
| RefSeq ORF | 1122 bp |
| Locus ID | 4094 |
| UniProt ID | O75444 |
| Protein Families | Druggable Genome, Transcription Factors |
| Gene Summary | The protein encoded by this gene is a DNA-binding, leucine zipper-containing transcription factor that acts as a homodimer or as a heterodimer. Depending on the binding site and binding partner, the encoded protein can be a transcriptional activator or repressor. This protein plays a role in the regulation of several cellular processes, including embryonic lens fiber cell development, increased T-cell susceptibility to apoptosis, and chondrocyte terminal differentiation. Defects in this gene are a cause of juvenile-onset pulverulent cataract as well as congenital cerulean cataract 4 (CCA4). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2010] Transcript Variant: This variant (2) represents an unspliced transcript compared to variant 1, which results in a frame-shift and a shorter isoform (b) with a distinct C-terminus compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no quality transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC209247 | MAF (Myc-DDK-tagged)-Human v-maf musculoaponeurotic fibrosarcoma oncogene homolog (avian) (MAF), transcript variant 2 |
CNY 5,488.00 |
|
| RC209247L1 | Lenti-ORF clone of MAF (Myc-DDK-tagged)-Human v-maf musculoaponeurotic fibrosarcoma oncogene homolog (avian) (MAF), transcript variant 2 |
CNY 5,890.00 |
|
| RC209247L2 | Lenti-ORF clone of MAF (mGFP-tagged)-Human v-maf musculoaponeurotic fibrosarcoma oncogene homolog (avian) (MAF), transcript variant 2 |
CNY 7,888.00 |
|
| RC209247L3 | Lenti-ORF clone of MAF (Myc-DDK-tagged)-Human v-maf musculoaponeurotic fibrosarcoma oncogene homolog (avian) (MAF), transcript variant 2 |
CNY 5,890.00 |
|
| RC209247L4 | Lenti-ORF clone of MAF (mGFP-tagged)-Human v-maf musculoaponeurotic fibrosarcoma oncogene homolog (avian) (MAF), transcript variant 2 |
CNY 5,890.00 |
|
| RG209247 | MAF (tGFP-tagged) - Human v-maf musculoaponeurotic fibrosarcoma oncogene homolog (avian) (MAF), transcript variant 2 |
CNY 4,370.00 |
