BOLA2 (NM_001031827) Human Untagged Clone
CAT#: SC302604
BOLA2 (untagged)-Human bolA homolog 2 (E. coli) (BOLA2)
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BOLA2A; BOLA2B; My016 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_001031827 edited
CTTCCTCCCGGCACAGAAGGCCTCCCCCTCTCACCAGGGCCCTCGCCCGCTGGTCCGCCA GGCCCCGCCTTTTTTGCGGCCCCCATTGTGCTGCTGGACCCGACGAGCAGTGTTGACAGT GAACCCCACGTAGACGCGGCCCCGGTACCGGGGGTTCAGGCAGTAGAGCAGGTAGACGCC GAAAAAGCGCCCTGGCCTCGCCGCGACCCCCGCGGGACCCATCGGGCCTTGGGGTTCGGG AACCACAGCAGGGGGTTGATTGCCGTGACCTAGGGTCCAGGGGAGGGCTGGATCGCTAGG GCTGCAGGGTGCTTGCTTCGGAACAAGCTCTCGGGGACTATCCGGAGGCAGCCTGCAGGA AGCCGTAGCGCCGGTACGTGCCCCTCTCCTGTCTGGAGGCGGGTGTAGAAGTCCGACCGC GGAAGCCAGACTGCTGTCCAGTCGGCGAGCGCGTACCATTCAGCATCGGCTCCGCCCGAG TCCCACCTTCCTCAGGCTCTGATTGGCTGACACATGGCAAGCGCGAAAAGCCTGGACCGC TGGAAAGCCCGGCTGCTTGAGGGCGGAAGTACTGCGTTGACGTACGCCTTAGTAAGGGCG GAAGTGAGTTTTCCAGCGGAAGTGGCTCCTGTAAGGCAGCAAGGTAGCGTGGCCGGCGCC CGAGCTGGGGTTGTGTCCCTGCTGGGCTGCCGTTCCAGCTGGACTGCCGCCATGGAACTC AGCGCCGAATACCTCCGCGAGAAGCTGCAGCGGGACCTGGAGGCGGAGCATGTGGAGGTG GAGGACACGACCCTCAACCGTTGCTCCTGTAGCTTCCGAGTCCTGGTGGTGTCGGCCAAG TTCGAGGGGAAACCGCTGCTTCAGAGACACAGGCTGGTGAACGCGTGCCTAGCAGAAGAG CTCCCGCACATCCATGCCTTTGAACAGAAAACCCTGACCCCAGACCAGTGGGCACGTGAG CGACAGAAATGAGGGACTGGGATCTGCACAGCCATTAAATTATAAATCTGGAAAAAAAAA AAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_001031827 |
Insert Size | 1000 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001031827.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001031827.1, NP_001026997.1 |
RefSeq Size | 1030 bp |
RefSeq ORF | 459 bp |
Locus ID | 552900 |
UniProt ID | Q9H3K6 |
Gene Summary | This gene is located within a region of a segmental duplication on chromosome 16 and is identical to BOLA2B (bolA family member 2B). The product of this gene belongs to a family of proteins that are widely conserved and may be involved in iron maturation. Related pseudogenes are found multiple different chromosomes. Alternative splicing results in multiple transcript variants. Transcripts initiating at this locus may extend into downstream SMG1 pseudogene 6 (SMG1P6) and encode fusion proteins with a C-terminus related to SMG1 phosphatidylinositol 3-kinase-related kinase. A readthrough locus is represented with GeneID:107282092. [provided by RefSeq, Feb 2016] Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214852 | BOLA2 (Myc-DDK-tagged)-Human bolA homolog 2 (E. coli) (BOLA2) |
CNY 1,200.00 |
|
RC214852L3 | Lenti ORF clone of Human bolA homolog 2 (E. coli) (BOLA2), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC214852L4 | Lenti ORF clone of Human bolA homolog 2 (E. coli) (BOLA2), mGFP tagged |
CNY 5,890.00 |
|
RG214852 | BOLA2 (tGFP-tagged) - Human bolA homolog 2 (E. coli) (BOLA2) |
CNY 4,370.00 |