MMP28 (NM_001032278) Human Untagged Clone
CAT#: SC302618
MMP28 (untagged)-Human matrix metallopeptidase 28 (MMP28), transcript variant 3
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | EPILYSIN; MM28; MMP-25; MMP-28; MMP25 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC302618 representing NM_001032278.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGTCGCGCGCGTCGGCCTCCTGCTGCGCGCCCTGCAGCTGCTACTGTGGGGCCACCTGGACGCCCAG CCCGCGGAGCGCGGAGGCCAGGAGCTGCGCAAGGAGGCGGAGGCATTCCTAGAGAAGTACGGATACCTC AATGAACAGGTCCCCAAAGCTCCCACCTCCACTCGATTCAGCGATGCCATCAGAGCGTTTCAGTGGGTG TCCCAGCTACCTGTCAGCGGCGTGTTGGACCGCGCCACCCTGCGCCAGATGACTCGTCCCCGCTGCGGG GTTACAGATACCAACAGTTATGCGGCCTGGGCTGAGAGGATCAGTGACTTGTTTGCTAGACACCGGACC AAAATGAGGCGTAAGAAACGCTTTGCAAAGCAAGGTGAGCACTGTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001032278 |
Insert Size | 393 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001032278.2 |
RefSeq Size | 1113 bp |
RefSeq ORF | 393 bp |
Locus ID | 79148 |
UniProt ID | Q9H239 |
Protein Families | Druggable Genome, Protease, Secreted Protein |
MW | 14.9 kDa |
Gene Summary | Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix for both normal physiological processes, such as embryonic development, reproduction and tissue remodeling, and disease processes, such as asthma and metastasis. This gene encodes a secreted enzyme that degrades casein. Its expression pattern suggests that it plays a role in tissue homeostasis and in wound repair. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2014] Transcript Variant: This variant (3) lacks multiple 3' exons but includes an alternate 3' terminal exon, and it thus differs in its 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (3) has a distinct C-terminus and is significantly shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218383 | MMP28 (Myc-DDK-tagged)-Human matrix metallopeptidase 28 (MMP28), transcript variant 3 |
CNY 1,200.00 |
|
RC218383L3 | Lenti ORF clone of Human matrix metallopeptidase 28 (MMP28), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC218383L4 | Lenti ORF clone of Human matrix metallopeptidase 28 (MMP28), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
RG218383 | MMP28 (tGFP-tagged) - Human matrix metallopeptidase 28 (MMP28), transcript variant 3 |
CNY 4,370.00 |