TFPI (NM_001032281) Human Untagged Clone

CAT#: SC302621

TFPI (untagged)-Human tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) (TFPI), transcript variant 2



  "NM_001032281" in other vectors (4)

CNY 2,400.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TFPI mouse monoclonal antibody, clone OTI5A2 (formerly 5A2)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms EPI; LACI; TFI; TFPI1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC302621 representing NM_001032281.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGATTTACACAATGAAGAAAGTACATGCACTTTGGGCTTCTGTATGCCTGCTGCTTAATCTTGCCCCT
GCCCCTCTTAATGCTGATTCTGAGGAAGATGAAGAACACACAATTATCACAGATACGGAGTTGCCACCA
CTGAAACTTATGCATTCATTTTGTGCATTCAAGGCGGATGATGGCCCATGTAAAGCAATCATGAAAAGA
TTTTTCTTCAATATTTTCACTCGACAGTGCGAAGAATTTATATATGGGGGATGTGAAGGAAATCAGAAT
CGATTTGAAAGTCTGGAAGAGTGCAAAAAAATGTGTACAAGAGATAATGCAAACAGGATTATAAAGACA
ACATTGCAACAAGAAAAGCCAGATTTCTGCTTTTTGGAAGAAGATCCTGGAATATGTCGAGGTTATATT
ACCAGGTATTTTTATAACAATCAGACAAAACAGTGTGAACGTTTCAAGTATGGTGGATGCCTGGGCAAT
ATGAACAATTTTGAGACACTGGAAGAATGCAAGAACATTTGTGAAGATGGTCCGAATGGTTTCCAGGTG
GATAATTATGGAACCCAGCTCAATGCTGTGAATAACTCCCTGACTCCGCAATCAACCAAGGTTCCCAGC
CTTTTTGTTACAAAAGAAGGAACAAATGATGGTTGGAAGAATGCGGCTCATATTTACCAAGTCTTTCTG
AACGCCTTCTGCATTCATGCATCCATGTTCTTTCTAGGATTGGATAGCATTTCATGCCTATGTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001032281
Insert Size 756 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001032281.3
RefSeq Size 1179 bp
RefSeq ORF 756 bp
Locus ID 7035
UniProt ID P10646
Protein Families Secreted Protein
Protein Pathways Complement and coagulation cascades
MW 28.7 kDa
Gene Summary This gene encodes a Kunitz-type serine protease inhibitor that regulates the tissue factor (TF)-dependent pathway of blood coagulation. The coagulation process initiates with the formation of a factor VIIa-TF complex, which proteolytically activates additional proteases (factors IX and X) and ultimately leads to the formation of a fibrin clot. The product of this gene inhibits the activated factor X and VIIa-TF proteases in an autoregulatory loop. Inhibition of the encoded protein restores hemostasis in animal models of hemophilia. This gene encodes multiple protein isoforms that differ in their inhibitory activity, specificity and cellular localization. [provided by RefSeq, Jul 2016]
Transcript Variant: This variant (2) uses an alternate in-frame exon in the 3' coding region compared to variant 1. The encoded isoform (b, also known as TFPIbeta) has a shorter and distinct C-terminus, which includes a glycosylphosphatidylinositol (GPI) anchor attachment site, compared to isoform a. Variants 2 and 3 both encode the same isoform (b).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...