MST3 (STK24) (NM_001032296) Human Untagged Clone
CAT#: SC302633
STK24 (untagged)-Human serine/threonine kinase 24 (STK24), transcript variant 2
CNY 5,488.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HEL-S-95; MST3; MST3B; STE20; STK3 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_003576 edited
GGGCGGCCGCGAATTCGGCACGAGGCTCCGGCCGGCCCCGCCGCCCGAGGGCTGCGCGCG GCCCGCGGGCCTCGCCGCCCCGCGCGGATCGTCGCGGCCCGGCCGTCCCGTCCCAGGAAG TGGCCGTCCTGAGCGCCATGGCTCACTCCCCGGTGCAGTCGGGCCTGCCCGGCATGCAGA ACCTAAAGGCAGACCCAGAAGAGCTTTTTACAAAACTAGAGAAAATTGGGAAGGGCTCCT TTGGAGAGGTGTTCAAAGGCATTGACAATCGGACTCAGAAAGTGGTTGCCATAAAGATCA TTGATCTGGAAGAAGCTGAAGATGAGATAGAGGACATTCAACAAGAAATCACAGTGCTGA GTCAGTGTGACAGTCCATATGTAACCAAATATTATGGATCCTATCTGAAGGATACAAAAT TATGGATAATAATGGAATATCTTGGTGGAGGCTCCGCACTAGATCTATTAGAACCTGGCC CATTAGATGAAACCCAGATCGCTACTATATTAAGAGAAATACTGAAAGGACTCGATTATC TCCATTCGGAGAAGAAAATCCACAGAGACATTAAAGCGGCCAACGTCCTGCTGTCTGAGC ATGGCGAGGTGAAGCTGGCGGACTTTGGCGTGGCTGGCCAGCTGACAGACACCCAGATCA AAAGGAACACCTTCGTGGGCACCCCATTCTGGATGGCACCCGAGGTCATCAAACAGTTGG CCTATGACTCGAAGGCAGACATCTGGTCCCTGGGCATAACAGCTATTGAACTTGCAAGAG GGGAACCACCTCATTCCGAGCTGCACCCCATGAAAGTTTTATTCCTCATTCCAAAGAACA ACCCACCGACGTTGGAAGGAAACTACAGTAAACCCCTCAAGGAGTTTGTGGAGGCCTGTT TGAATAAGGAGCCGAGCTTTAGACCCACTGCTAAGGAGTTATTGAAGCACAAGTTTATAC TACGCAATGCAAAGAAAACTTCCTACTTGACCGAGCTCATCGACAGGTACAAGAGATGGA AGGCCGAGCAGAGCCATGACGACTCGAGCTCCGAGGATTCCGACGCGGAAACAGATGGCC AAGCCTCGGGGGGCAGTGATTCTGGGGACTGGATCTTCACAATCCGAGAAAAAGATCCCA AGAATCTCGAGAATGGAGCTCTTCAGCCATCGGACTTGGACAGAAATAAGATGAAAGACA TCCCAAAGAGGCCTTTCTCTCAGTGTTTATCTACAATTATTTCTCCTCTGTTTGCAGAGT TGAAGGAGAAGAGCCAGGCGTGCGGAGGGAACTTGGGGTCCATTGAAGAGCTGCGAGGGG CCATCTACCTAGCGGAGGAGGCGTGCCCTGGCATCTCCGACACCATGGTGGCCCAGCTCG TGCAGCGGCTCCAGAGATACTCTCTAAGTGGTGGAGGAACTTCATCCCACTGA |
Restriction Sites | Please inquire |
ACCN | NM_001032296 |
Insert Size | 2400 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | The ORF of this clone has been fully sequenced and found to contain one SNP compared with NM_001032296.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001032296.1, NP_001027467.1 |
RefSeq Size | 2636 bp |
RefSeq ORF | 1296 bp |
Locus ID | 8428 |
UniProt ID | Q9Y6E0 |
Protein Families | Druggable Genome, Protein Kinase |
Gene Summary | This gene encodes a serine/threonine protein kinase that functions upstream of mitogen-activated protein kinase (MAPK) signaling. The encoded protein is cleaved into two chains by caspases; the N-terminal fragment (MST3/N) translocates to the nucleus and promotes programmed cells death. There is a pseudogene for this gene on chromosome X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013] Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (b) has a distinct N-terminus and is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC209117 | STK24 (Myc-DDK-tagged)-Human serine/threonine kinase 24 (STK24), transcript variant 2 |
CNY 5,488.00 |
|
RC209117L3 | Lenti-ORF clone of STK24 (Myc-DDK-tagged)-Human serine/threonine kinase 24 (STK24), transcript variant 2 |
CNY 5,890.00 |
|
RC209117L4 | Lenti-ORF clone of STK24 (mGFP-tagged)-Human serine/threonine kinase 24 (STK24), transcript variant 2 |
CNY 5,890.00 |
|
RG209117 | STK24 (tGFP-tagged) - Human serine/threonine kinase 24 (STK24), transcript variant 2 |
CNY 4,370.00 |