RPL3 (NM_001033853) Human Untagged Clone
CAT#: SC302771
RPL3 (untagged)-Human ribosomal protein L3 (RPL3), transcript variant 2
CNY 3,656.00
CNY 5,700.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ASC-1; L3; TARBP-B |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_001033853 edited
TTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACATGGGTCCCTCGGCTTCC TGCCTCGGAAGCGCAGCAGCAGGCATCGTGGGAAGGTGAAGAGCTTCCCTAAGGATGACC CATCCAAGCCGGTCCACCTCACAGCCTTCCTGGGATACAAGGCTGGCATGACTCACATCG TGCGGGAAGTCGACAGGCCGGGATCCAAGGTGAACAAGAAGGAGGTGGTGGAGGCTGTGA CCATTGTAGAGACACCACCCATGGTGGTTGTGGGCATTGTGGGCTACGTGGAAACCCCTC GAGGCCTCCGGACCTTCAAGACTGTCTTTGCTGAGCACATCAGTGATGAATGCAAGAGGC GTTTCTATAAGAATTGGCATAAATCTAAGAAGAAGGCCCACCTGATGGAGATCCAGGTGA ACGGAGGCACTGTGGCCGAGAAGCTGGACTGGGCCCGCGAGAGGCTTGAGCAGCAGGTAC CTGTGAACCAAGTGTTTGGGCAGGATGAGATGATCGACGTCATCGGGGTGACCAAGGGCA AAGGCTACAAAGGGGTCACCAGTCGTTGGCACACCAAGAAGCTGCCCCGCAAGACCCACC GAGGCCTGCGCAAGGTGGCCTGTATTGGGGCATGGCATCCTGCTCGTGTAGCCTTCTCTG TGGCACGCGCTGGGCAGAAAGGCTACCATCACCGCACTGAGATCAACAAGAAGATTTATA AGATTGGCCAGGGCTACCTTATCAAGGACGGCAAGCTGATCAAGAACAATGCCTCCACTG ACTATGACCTATCTGACAAGAGCATCAACCCTCTGGGTGGCTTTGTCCACTATGGTGAAG TGACCAATGACTTTGTCATGCTGAAAGGCTGTGTGGTGGGAACCAAGAAGCGGGTGCTCA CCCTCCGCAAGTCCTTGCTGGTGCAGACGAAGCGGCGGGCTCTGGAGAAGATTGACCTTA AGTTCATTGACACCACCTCCAAGTTTGGCCATGGCCGCTTCCAGACCATGGAGGAGAAGA AAGCATTCATGGGACCACTGAAGAAAGACCGAATTGCAAAGGAAGAAGGAGCTTAATGCC AGGAACAGATTTTGCAGTTGGTGGGGTCTCAATAAAAGTTATTTTCCACTGAAAAAAAAA AAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_001033853 |
Insert Size | 1100 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001033853.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001033853.1, NP_001029025.1 |
RefSeq Size | 1201 bp |
RefSeq ORF | 1065 bp |
Locus ID | 6122 |
Protein Pathways | Ribosome |
Gene Summary | Ribosomes, the complexes that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L3P family of ribosomal proteins and it is located in the cytoplasm. The protein can bind to the HIV-1 TAR mRNA, and it has been suggested that the protein contributes to tat-mediated transactivation. This gene is co-transcribed with several small nucleolar RNA genes, which are located in several of this gene's introns. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) uses alternate in-frame splice sites in two exons, compared to variant 1, resulting in a shorter protein (isoform b). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC217987 | RPL3 (Myc-DDK-tagged)-Human ribosomal protein L3 (RPL3), transcript variant 2 |
CNY 3,656.00 |
|
RC217987L3 | Lenti ORF clone of Human ribosomal protein L3 (RPL3), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC217987L4 | Lenti ORF clone of Human ribosomal protein L3 (RPL3), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG217987 | RPL3 (tGFP-tagged) - Human ribosomal protein L3 (RPL3), transcript variant 2 |
CNY 4,370.00 |