United States
Germany
Japan
United Kingdom
China
VPS26 (VPS26A) (NM_001035260) Human Untagged Clone
CAT＃: SC302832
VPS26A (untagged)-Human vacuolar protein sorting 26 homolog A (S. pombe) (VPS26A), transcript variant 2
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | HB58; Hbeta58; PEP8A; VPS26 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC302832 representing NM_001035260.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAGTTTTCTTGGAGGCTTTTTTGGTCCAATTTGTGAGATCGATATTGTTCTTAATGATGGGGAAACC AGGAAAATGGCAGAAATGAAAACTGAAGATGGCAAAGTAGAAAAACACTATCTCTTCTATGACGGAGAA TCCGTTTCAGGAAAGGTAAACCTAGCCTTTAAGCAACCTGGAAAGAGGCTAGAACACCAAGGAATTAGA ATTGAATTTGTAGGTCAAATTGAACTTTTCAATGACAAGAGTAATACTCATGAATTTGTAAACCTAGTG AAAGAACTAGCCTTACCTGGAGAACTGACTCAGAGCAGAAGTTATGATTTTGAATTTATGCAAGTTGAA AAGCCATATGAATCTTACATCGGTGCCAATGTCCGCTTGAGGTATTTTCTTAAAGTGACAATAGTGAGA AGACTGACAGATTTGGTAAAAGAGTATGATCTTATTGTTCACCAGCTTGCCACCTATCCTGATGTTAAC AACTCTATTAAGATGGAAGTGGGCATTGAAGATTGTCTACATATAGAATTTGAATATAATAAATCAAAG TATCATTTAAAGGATGTGATTGTTGGAAAAATTTACTTCTTATTAGTAAGAATAAAAATACAACATATG GAGTTACAGCTGATCAAAAAAGAGATCACAGGAATTGGACCCAGTACCACAACAGAAACAGAAACAATC GCCAAATATGAAATAATGGATGGTGCACCAGTAAAAGGAGATAATTTTATGGAGAAAAGCTCCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001035260 |
| Insert Size | 756 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001035260.2 |
| RefSeq Size | 4137 bp |
| RefSeq ORF | 756 bp |
| Locus ID | 9559 |
| UniProt ID | O75436 |
| MW | 28.9 kDa |
| Gene Summary | This gene belongs to a group of vacuolar protein sorting (VPS) genes. The encoded protein is a component of a large multimeric complex, termed the retromer complex, involved in retrograde transport of proteins from endosomes to the trans-Golgi network. The close structural similarity between the yeast and human proteins that make up this complex suggests a similarity in function. Expression studies in yeast and mammalian cells indicate that this protein interacts directly with VPS35, which serves as the core of the retromer complex. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks an exon in the 3' coding region which results in a frameshift and early translation termination, compared to variant 1. The encoded isoform (2) has a shorter and distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC215611 | VPS26A (Myc-DDK-tagged)-Human vacuolar protein sorting 26 homolog A (S. pombe) (VPS26A), transcript variant 2 |
CNY 2,400.00 |
|
| RC215611L3 | Lenti ORF clone of Human vacuolar protein sorting 26 homolog A (S. pombe) (VPS26A), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC215611L4 | Lenti ORF clone of Human vacuolar protein sorting 26 homolog A (S. pombe) (VPS26A), transcript variant 2, mGFP tagged |
CNY 4,800.00 |
|
| RG215611 | VPS26A (tGFP-tagged) - Human vacuolar protein sorting 26 homolog A (S. pombe) (VPS26A), transcript variant 2 |
CNY 4,370.00 |
