SDHC (NM_001035512) Human Untagged Clone
CAT#: SC302838
SDHC (untagged)-Human succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa (SDHC), nuclear gene encoding mitochondrial protein, transcript variant 3
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CYB560; CYBL; PGL3; QPS1; SDH3 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001035512, the custom clone sequence may differ by one or more nucleotides
ATGGCTGCGCTGTTGCTGAGACACGTTGGTCGTCATTGCCTCCGAGCCCACTTTAGCCCT CAGCTCTGTATCAGAAATTGGTCTCTTCCCATGGCGATGTCCATCTGCCACCGTGGCACT GGTATTGCTTTGAGTGCAGGGGTCTCTCTTTTTGGCATGTCGGCCCTGTTACTCCCTGGG AACTTTGAGTCTTATTTGGAACTTGTGAAGTCCCTGTGTCTGGGGCCAGCACTGATCCAC ACAGCTAAGTTTGCACTTGTCTTCCCTCTCATGTATCATACCTGGAATGGGATCCGACAC TTGATGTGGGACCTAGGAAAAGGCCTGAAGATTCCCCAGCTATACCAGTCTGGAGTGGTT GTCCTGGTTCTTACTGTGTTGTCCTCTATGGGGCTGGCAGCCATGTGA |
Restriction Sites | Please inquire |
ACCN | NM_001035512 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001035512.1, NP_001030589.1 |
RefSeq Size | 2756 bp |
RefSeq ORF | 408 bp |
Locus ID | 6391 |
UniProt ID | Q99643 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Alzheimer's disease, Citrate cycle (TCA cycle), Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease |
Gene Summary | This gene encodes one of four nuclear-encoded subunits that comprise succinate dehydrogenase, also known as mitochondrial complex II, a key enzyme complex of the tricarboxylic acid cycle and aerobic respiratory chains of mitochondria. The encoded protein is one of two integral membrane proteins that anchor other subunits of the complex, which form the catalytic core, to the inner mitochondrial membrane. There are several related pseudogenes for this gene on different chromosomes. Mutations in this gene have been associated with paragangliomas. Alternatively spliced transcript variants have been described. [provided by RefSeq, May 2013] Transcript Variant: This variant (3, also known as delta3) lacks an alternate exon in the 5' coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (3) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222196 | SDHC (Myc-DDK-tagged)-Human succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa (SDHC), nuclear gene encoding mitochondrial protein, transcript variant 3 |
CNY 3,990.00 |
|
RC222196L3 | Lenti-ORF clone of SDHC (Myc-DDK-tagged)-Human succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa (SDHC), nuclear gene encoding mitochondrial protein, transcript variant 3 |
CNY 5,890.00 |
|
RC222196L4 | Lenti-ORF clone of SDHC (mGFP-tagged)-Human succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa (SDHC), nuclear gene encoding mitochondrial protein, transcript variant 3 |
CNY 5,890.00 |
|
RG222196 | SDHC (tGFP-tagged) - Human succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa (SDHC), nuclear gene encoding mitochondrial protein, transcript variant 3 |
CNY 4,370.00 |