ARL4 (ARL4A) (NM_001037164) Human Untagged Clone
CAT#: SC302858
ARL4A (untagged)-Human ADP-ribosylation factor-like 4A (ARL4A), transcript variant 3
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ARL4 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC302858 representing NM_001037164.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGGAATGGGCTGTCAGACCAGACTTCTATCCTGTCCAACCTGCCTTCATTTCAGTCTTTCCACATT GTTATTCTGGGTTTGGACTGTGCTGGAAAGACAACTGTCTTATACAGGCTGCAGTTCAATGAATTTGTA AATACCGTACCTACCAAAGGATTTAACACTGAGAAAATTAAGGTAACCTTGGGAAATTCTAAAACAGTC ACTTTTCACTTCTGGGATGTAGGTGGTCAGGAGAAATTAAGGCCACTGTGGAAGTCATATACCAGATGC ACAGATGGCATTGTATTTGTTGTGGACTCTGTTGATGTCGAAAGGATGGAAGAAGCCAAAACTGAACTT CACAAAATAACTAGGATATCAGAAAATCAGGGAGTCCCTGTACTTATAGTTGCTAACAAACAAGATTTG AGGAACTCATTGTCACTTTCAGAAATTGAGAAATTGTTAGCAATGGGTGAACTGAGCTCATCAACTCCT TGGCATTTGCAGCCTACCTGTGCAATCATAGGAGATGGCCTAAAGGAAGGACTTGAGAAACTACATGAT ATGATCATTAAAAGAAGAAAAATGTTGCGGCAACAGAAAAAGAAAAGATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001037164 |
Insert Size | 603 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001037164.2 |
RefSeq Size | 2986 bp |
RefSeq ORF | 603 bp |
Locus ID | 10124 |
UniProt ID | P40617 |
Protein Families | Stem cell - Pluripotency |
MW | 22.6 kDa |
Gene Summary | ADP-ribosylation factor-like 4A is a member of the ADP-ribosylation factor family of GTP-binding proteins. ARL4A is similar to ARL4C and ARL4D and each has a nuclear localization signal and an unusually high guaninine nucleotide exchange rate. ARL4A is located in both the nuclear and extranuclear cell compartments. Multiple transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. All four variants encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC207296 | ARL4A (Myc-DDK-tagged)-Human ADP-ribosylation factor-like 4A (ARL4A), transcript variant 3 |
CNY 2,400.00 |
|
RC207296L3 | Lenti ORF clone of Human ADP-ribosylation factor-like 4A (ARL4A), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC207296L4 | Lenti ORF clone of Human ADP-ribosylation factor-like 4A (ARL4A), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
RG207296 | ARL4A (tGFP-tagged) - Human ADP-ribosylation factor-like 4A (ARL4A), transcript variant 3 |
CNY 4,370.00 |