CCDC46 (CEP112) (NM_001037325) Human Untagged Clone

CAT#: SC302884

CEP112 (untagged)-Human centrosomal protein 112kDa (CEP112), transcript variant 2



  "NM_001037325" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-CEP112 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CCDC46; MACOCO; SPGF44
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC302884 representing NM_001037325.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTGGGCTTCTCTGAGTTTAGACCATCCATCTGCCAAGGAAAACCAAGCCCTGAGACTGATAGAGATG
AGAGAAGAGAATGGTAATGTCCCCAAGACAGAGCAGGCAGGAAGTTTGAAGCCTCTGAGGGATACAGGA
AAATCTAACCTCAAAGAGAAGAAGGCCAACAGCAAGCTGAAGCAGATTGAGAAGGAATACACTCAGAAG
CTTGCCAAATCTTCACAGATCATAGCAGAACTTCAGACAACCATTTCCTCTCTGAAAGAAGAGAACAGC
CAGCAGCAGCTTGCTGCAGAAAGGCGGCTCCAGGATGTTAGACAAAAGTTTGAAGATGAGAAGAAGCAG
CTGATTAGAGATAATGACCAAGCAATCAAGGTTTTACAAGATGAATTAGAAAACCGTTCTAATCAGGTG
CGATGTGCAGAGAAAAAATTACAACACAAAGAATTGGAGTCACAGGAACAGATAACTTACATACGACAA
GAATATGAAACAAAATTGAAAGGATTGATGCCAGCATCCCTAAGACAAGAACTTGAAGACACCATTTCC
TCCCTAAAATCACAGGTTAATTTTCTGCAAAAGAGAGCTTCCATCCTTCAGGAAGAACTGACTACATAT
CAAGGCAGAAGGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001037325
Insert Size 636 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001037325.2
RefSeq Size 1318 bp
RefSeq ORF 636 bp
Locus ID 201134
UniProt ID Q8N8E3
MW 24.5 kDa
Gene Summary This gene encodes a coiled-coil domain containing protein that belongs to the cell division control protein 42 effector protein family. In neurons, it localizes to the cytoplasm of dendrites and is also enriched in the nucleus where it interacts with the RNA polymerase III transcriptional repressor Maf1 to regulate gamma-aminobutyric acid A receptor surface expression. In addition, the protein has been identified as a component of the human centrosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Transcript Variant: This variant (2) contains a distinct 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon compared to variant 3. The encoded isoform (b) has a distinct N-terminus and is shorter than isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...