Sex Hormone Binding Globulin (SHBG) (NM_001040) Human Untagged Clone
CAT#: SC302958
SHBG (untagged)-Human sex hormone-binding globulin (SHBG), transcript variant 1
CNY 3,656.00
CNY 7,220.00
Cited in 1 publication. |
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ABP; SBP; TEBG |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_001040 edited
ATGGAGAGCAGAGGCCCACTGGCTACCTCGCGCCTGCTGCTGTTGCTGCTGTTGCTACTA CTGCGTCACACCCGCCAGGGATGGGCCCTGAGACCTGTTCTCCCCACCCAGAGTGCCCAC GACCCTCCGGCTGTCCACCTCAGCAATGGCCCAGGACAAGAGCCTATCGCTGTCATGACC TTTGACCTCACCAAGATCACAAAAACCTCCTCCTCCTTTGAGGTTCGAACCTGGGACCCA GAGGGAGTGATTTTTTATGGGGATACCAACCCTAAGGATGACTGGTTTATGCTGGGACTT CGAGACGGCAGGCCTGAGATCCAACTGCACAATCACTGGGCCCAGCTTACGGTGGGTGCT GGACCACGGCTGGATGATGGGAGATGGCACCAGGTGGAAGTCAAGATGGAGGGGGACTCT GTGCTGCTGGAGGTGGATGGGGAGGAGGTGCTGCGCCTGAGACAGGTCTCTGGGCCCCTG ACCAGCAAACGCCATCCCATCATGAGGATTGCGCTTGGGGGGCTGCTCTTCCCCGCTTCC AACCTTCGGTTGCCGCTGGTTCCTGCCCTGGATGGCTGCCTGCGCCGGGATTCCTGGCTG GACAAACAGGCCGAGATCTCAGCATCTGCCCCCACTAGCCTCAGAAGCTGTGATGTAGAA TCAAATCCCGGGATATTTCTCCCTCCAGGGACTCAGGCAGAATTCAATCTCCGAGACATT CCCCAGCCTCATGCAGAGCCCTGGGCCTTCTCTTTGGACCTGGGACTCAAGCAGGCAGCA GGCTCAGGCCACCTCCTTGCTCTTGGGACACCAGAGAACCCATCTTGGCTCAGTCTCCAC CTCCAAGATCAAAAGGTGGTGTTGTCTTCTGGGTCGGGGCCAGGGCTGGATCTGCCCCTG GTCTTGGGACTCCCTCTTCAGCTGAAGCTGAGTATGTCCAGGGTGGTCTTGAGCCAAGGG TCGAAGATGAAGGCCCTTGCCCTGCCTCCCTTAGGCCTGGCTCCCCTCCTTAACCTCTGG GCCAAGCCTCAAGGGCGTCTCTTCCTGGGGGCTTTACCAGGAGAAGACTCTTCCACCTCT TTTTGCCTGAATGGCCTTTGGGCACAAGGTCAGAGGCTGGATGTGGACCAGGCCCTGAAC AGAAGCCATGAGATCTGGACTCACAGCTGCCCCCAGAGCCCAGGCAATGGCACTGACGCT TCCCATTAA |
Restriction Sites | Please inquire |
ACCN | NM_001040 |
Insert Size | 1200 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001040.2, NP_001031.2 |
RefSeq Size | 1209 bp |
RefSeq ORF | 1209 bp |
Locus ID | 6462 |
UniProt ID | P04278 |
Protein Families | Druggable Genome, Secreted Protein |
Gene Summary | This gene encodes a steroid binding protein that was first described as a plasma protein secreted by the liver but is now thought to participate in the regulation of steroid responses. The encoded protein transports androgens and estrogens in the blood, binding each steroid molecule as a dimer formed from identical or nearly identical monomers. Polymorphisms in this gene have been associated with polycystic ovary syndrome and type 2 diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014] Transcript Variant: This variant (1), which has also been referred to as SHBG-L, encodes the longest protein (isoform 1). |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Differential but Concerted Expression of HSD17B2, HSD17B3, SHBG and SRD5A1 Testosterone Tetrad Modulate Therapy Response and Susceptibility to Disease Relapse in Patients with Prostate Cancer
,null,
Cancers
,PubMed ID 34298692
[SHBG]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC211022 | SHBG (Myc-DDK-tagged)-Human sex hormone-binding globulin (SHBG), transcript variant 1 |
CNY 3,656.00 |
|
RC211022L1 | Lenti ORF clone of Human sex hormone-binding globulin (SHBG), transcript variant 1, Myc-DDK-tagged |
CNY 6,056.00 |
|
RC211022L2 | Lenti ORF clone of Human sex hormone-binding globulin (SHBG), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC211022L3 | Lenti ORF clone of Human sex hormone-binding globulin (SHBG), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC211022L4 | Lenti ORF clone of Human sex hormone-binding globulin (SHBG), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG211022 | SHBG (tGFP-tagged) - Human sex hormone-binding globulin (SHBG), transcript variant 1 |
CNY 4,370.00 |
其它Sex Hormone Binding Globulin产品