GALR1 (NM_001480) Human Untagged Clone

CAT#: SC303029

GALR1 (untagged)-Human galanin receptor 1 (GALR1)



  "NM_001480" in other vectors (4)

CNY 3,656.00

CNY 5,700.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Galanin Receptor 1 / GALR1 Rabbit Polyclonal (Extracellular Domain) Antibody
    • 50 ug

CNY 5,654.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GALNR; GALNR1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_001480 edited
ATGGAGCTGGCGGTCGGGAACCTCAGCGAGGGCAACGCGAGCTGGCCGGAGCCCCCCGCC
CCGGAGCCCGGGCCGCTGTTCGGCATCGGCGTGGAGAACTTCGTCACGCTGGTGGTGTTC
GGCCTGATCTTCGCGCTGGGCGTGCTGGGCAACAGCCTAGTGATCACCGTGCTGGCGCGC
AGCAAGCCGGGCAAGCCGCGGAGCACCACCAACCTGTTCATCCTCAACCTGAGCATCGCC
GACCTGGCCTACCTGCTCTTCTGCATCCCCTTCCAGGCCACCGTGTACGCGCTGCCCACC
TGGGTGCTGGGCGCCTTCATCTGCAAGTTCATCCACTACTTCTTCACCGTGTCCATGCTG
GTGAGCATCTTCACCCTGGCCGCGATGTCCGTGGACCGCTACGTGGCCATCGTGCACTCG
CGGCGCTCCTCCTCCCTCAGGGTGTCCCGCAACGCGCTGCTGGGCGTGGGCTGCATCTGG
GCGCTGTCCATTGCCATGGCCTCGCCCGTGGCCTACCACCAGGGCCTCTTCCACCCGCGC
GCCAGCAACCAGACCTTCTGCTGGGAGCAGTGGCCCGACCCTCGCCACAAGAAGGCCTAC
GTGGTGTGCACCTTCGTCTTCGGCTACCTGCTGCCGCTCCTGCTCATCTGCTTCTGCTAT
GCCAAGGTCCTTAATCACTTGCATAAAAAGTTGAAGAACATGTCAAAGAAGTCTGAAGCA
TCCAAGAAAAAGACTGCACAGACAGTTCTGGTGGTGGTTGTGGTGTTTGGAATCTCCTGG
CTGCCGCACCACATCATCCATCTCTGGGCTGAGTTTGGAGTTTTCCCGCTGACGCCGGCT
TCCTTCCTCTTCAGAATCACCGCCCACTGCCTGGCGTACAGCAATTCCTCCGTGAATCCT
ATCATTTATGCATTTCTCTCTGAAAATTTCAGGAAGGCCTATAAACAAGTGTTCAAGTGT
CACATTCGCAAAGATTCACACCTGAGTGATACTAAAGAAAATAAAAGTCGAATAGACACC
CCACCATCAACCAATTGTACTCATGTGTGA
Restriction Sites Please inquire     
ACCN NM_001480
Insert Size 1000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001480.2.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001480.2, NP_001471.1
RefSeq Size 3056 bp
RefSeq ORF 1050 bp
Locus ID 2587
UniProt ID P47211
Protein Families Druggable Genome, Transmembrane
Protein Pathways Neuroactive ligand-receptor interaction
Gene Summary The neuropeptide galanin elicits a range of biological effects by interaction with specific G-protein-coupled receptors. Galanin receptors are seven-transmembrane proteins shown to activate a variety of intracellular second-messenger pathways. GALR1 inhibits adenylyl cyclase via a G protein of the Gi/Go family. GALR1 is widely expressed in the brain and spinal cord, as well as in peripheral sites such as the small intestine and heart. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...