GNRH2 (NM_001501) Human Untagged Clone

CAT#: SC303034

GNRH2 (untagged)-Human gonadotropin-releasing hormone 2 (GNRH2), transcript variant 1



  "NM_001501" in other vectors (4)

CNY 1,800.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
GNRH2 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GnRH-II; LH-RHII
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC303034 representing NM_001501.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCAGCTCCAGGCGAGGCCTCCTGCTCCTGCTGCTGCTGACTGCCCACCTTGGACCCTCAGAGGCT
CAGCACTGGTCCCATGGCTGGTACCCTGGAGGAAAGCGAGCCCTCAGCTCAGCCCAGGATCCCCAGAAT
GCCCTTAGGCCCCCAGGAAGGGCCCTGGACACTGCAGCAGGCAGCCCAGTCCAGACTGCCCATGGCCTC
CCAAGTGATGCCCTGGCTCCCCTGGACGACAGCATGCCCTGGGAGGGCAGGACCACGGCCCAGTGGTCC
CTTCACAGGAAGCGACACCTGGCACGGACACTGCTGACCGCAGCCCGAGAGCCCCGCCCCGCCCCGCCA
TCCTCCAATAAAGTGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001501
Insert Size 363 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001501.1
RefSeq Size 423 bp
RefSeq ORF 363 bp
Locus ID 2797
UniProt ID O43555
Protein Families Druggable Genome, Secreted Protein
Protein Pathways GnRH signaling pathway
MW 12.9 kDa
Gene Summary This gene is a member of the gonadotropin-releasing hormone (GnRH) gene family. Proteins encoded by members of this gene family are proteolytically cleaved to form neuropeptides which, in part, regulate reproductive functions by stimulating the production and release of the gonadotropins follicle-stimulating hormone (FSH) and luteinizing hormone (LH). The human GNRH2 gene is predicted to encode a preproprotein from which a mature neuropeptide of 10 amino acids is cleaved. However, while the human genome retains the sequence for a functional GNRH2 decapeptide, translation of the human GNRH2 gene has not yet been demonstrated and the GNRH2 gene of chimpanzees, gorilla, and Sumatran orangutan have a premature stop at codon eight of the decapeptide sequence which suggests GNRH2 was a pseudogene in the hominid lineage. The GNRH2 gene is also believed to be a pseudogene in many other mammalian species such as mouse and cow. The receptor for this gene (GNRHR2) is predicted to be a pseudogene in human as well as many other mammalian species. The closely related GNRH1 and GNRHR1 genes are functional in human and other mammals and are generally functional in vertebrates. [provided by RefSeq, Mar 2019]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a). Variants 1 and 4 encode the same isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...