Orexin (HCRT) (NM_001524) Human Untagged Clone

CAT#: SC303041

HCRT (untagged)-Human hypocretin (orexin) neuropeptide precursor (HCRT)



  "NM_001524" in other vectors (6)

CNY 1,200.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


HCRT(Orexin-B) rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms NRCLP1; OX; PPOX
Vector pCMV6-XL6
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_001524 edited
GGTACCAGACACCATGAACCTTCCTTCCACAAAGGTCTCCTGGGCCGCCGTGACGCTACT
GCTGCTGCTGCTGCTGCTGCCGCCCGCGCTGTTGTCGTCCGGGGCGGCTGCACAGCCCCT
GCCCGACTGCTGTCGTCAAAAGACTTGCTCTTGCCGCCTCTACGAGCTGCTGCACGGCGC
GGGCAATCACGCGGCCGGCATCCTCACGCTGGGCAAGCGGAGGTCCGGGCCCCCGGGCCT
CCAGGGTCGGCTGCAGCGCCTCCTGCAGGCCAGCGGCAACCACGCCGCGGGCATCCTGAC
CATGGGCCGCCGCGCAGGCGCAGAGCCAGCGCCGCGCCCCTGCCTCGGGCGCCGCTGTTC
CGCCCCGGCCGCCGCCTCCGTCGCGCCCGGAGGACAGTCCGGGATCTGAGTCGTTCTTCG
GGCCCTGTCCTGGCCCAGGCCTCTGCCCTCTGCCCACCCAGCGTCAGCCCCCAGAAAAAA
GGCAATAAAGACGAGTCTCCATCTAGA
Restriction Sites Please inquire     
ACCN NM_001524
Insert Size 500 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this clone has been fully sequenced and found to be a perfect match to the protein associated with this reference, NM_001524.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001524.1, NP_001515.1
RefSeq Size 577 bp
RefSeq ORF 396 bp
Locus ID 3060
UniProt ID O43612
Protein Families Druggable Genome, Transmembrane
Gene Summary This gene encodes a hypothalamic neuropeptide precursor protein that gives rise to two mature neuropeptides, orexin A and orexin B, by proteolytic processing. Orexin A and orexin B, which bind to orphan G-protein coupled receptors HCRTR1 and HCRTR2, function in the regulation of sleep and arousal. This neuropeptide arrangement may also play a role in feeding behavior, metabolism, and homeostasis. [provided by RefSeq, Jan 2010]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...