ICAM4 (NM_001544) Human Untagged Clone
CAT#: SC303044
ICAM4 (untagged)-Human intercellular adhesion molecule 4 (Landsteiner-Wiener blood group) (ICAM4), transcript variant 1
CNY 6,270.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CD242; LW |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC303044 representing NM_001544.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGGTCTCTGTTCCCTCTGTCGCTGCTGTTTTTTTTGGCGGCCGCCTACCCGGGAGTTGGGAGCGCG CTGGGACGCCGGACTAAGCGGGCGCAAAGCCCCAAGGGTAGCCCTCTCGCGCCCTCCGGGACCTCAGTG CCCTTCTGGGTGCGCATGAGCCCGGAGTTCGTGGCTGTGCAGCCGGGGAAGTCAGTGCAGCTCAATTGC AGCAACAGCTGTCCCCAGCCGCAGAATTCCAGCCTCCGCACCCCGCTGCGGCAAGGCAAGACGCTCAGA GGGCCGGGTTGGGTGTCTTACCAGCTGCTCGACGTGAGGGCCTGGAGCTCCCTCGCGCACTGCCTCGTG ACCTGCGCAGGAAAAACACGCTGGGCCACCTCCAGGATCACCGCCTACAAACCGCCCCACAGCGTGATT TTGGAGCCTCCGGTCTTAAAGGGCAGGAAATACACTTTGCGCTGCCACGTGACGCAGGTGTTCCCGGTG GGCTACTTGGTGGTGACCCTGAGGCATGGAAGCCGGGTCATCTATTCCGAAAGCCTGGAGCGCTTCACC GGCCTGGATCTGGCCAACGTGACCTTGACCTACGAGTTTGCTGCTGGACCCCGCGACTTCTGGCAGCCC GTGATCTGCCACGCGCGCCTCAATCTCGACGGCCTGGTGGTCCGCAACAGCTCGGCACCCATTACACTG ATGCTCGCTTGGAGCCCCGCGCCCACAGCTTTGGCCTCCGGTTCCATCGCTGCCCTTGTAGGGATCCTC CTCACTGTGGGCGCTGCGTACCTATGCAAGTGCCTAGCTATGAAGTCCCAGGCGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001544 |
Insert Size | 816 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001544.4 |
RefSeq Size | 1354 bp |
RefSeq ORF | 816 bp |
Locus ID | 3386 |
UniProt ID | Q14773 |
Protein Families | Secreted Protein, Transmembrane |
MW | 29.3 kDa |
Gene Summary | This gene encodes the Landsteiner-Wiener (LW) blood group antigen(s) that belongs to the immunoglobulin (Ig) superfamily, and that shares similarity with the intercellular adhesion molecule (ICAM) protein family. This ICAM protein contains 2 Ig-like C2-type domains and binds to the leukocyte adhesion LFA-1 protein. The molecular basis of the LW(A)/LW(B) blood group antigens is a single aa variation at position 100; Gln-100=LW(A) and Arg-100=LW(B). Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) encodes isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC205896 | ICAM4 (Myc-DDK-tagged)-Human intercellular adhesion molecule 4 (Landsteiner-Wiener blood group) (ICAM4), transcript variant 1 |
CNY 2,400.00 |
|
RC205896L1 | Lenti ORF clone of Human intercellular adhesion molecule 4 (Landsteiner-Wiener blood group) (ICAM4), transcript variant 1, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC205896L2 | Lenti ORF clone of Human intercellular adhesion molecule 4 (Landsteiner-Wiener blood group) (ICAM4), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC205896L3 | Lenti ORF clone of Human intercellular adhesion molecule 4 (Landsteiner-Wiener blood group) (ICAM4), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC205896L4 | Lenti ORF clone of Human intercellular adhesion molecule 4 (Landsteiner-Wiener blood group) (ICAM4), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG205896 | ICAM4 (tGFP-tagged) - Human intercellular adhesion molecule 4 (Landsteiner-Wiener blood group) (ICAM4), transcript variant 1 |
CNY 4,000.00 |
|
SC321125 | ICAM4 (untagged)-Human intercellular adhesion molecule 4 (Landsteiner-Wiener blood group) (ICAM4), transcript variant 1 |
CNY 2,400.00 |