Corticotropin Releasing Factor Receptor 2 (CRHR2) (NM_001883) Human Untagged Clone

CAT#: SC303088

CRHR2 (untagged)-Human corticotropin releasing hormone receptor 2 (CRHR2), transcript variant 1



  "NM_001883" in other vectors (6)

CNY 5,488.00

CNY 6,650.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-CRHR2 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CRF-RB; CRF2; CRFR2; HM-CRF
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001883, the custom clone sequence may differ by one or more nucleotides


ATGGACGCGGCACTGCTCCACAGCCTGCTGGAGGCCAACTGCAGCCTGGCGCTGGCTGAAGAGCTGCTCT
TGGACGGCTGGGGGCCACCCCTGGACCCCGAGGGTCCCTACTCCTACTGCAACACGACCTTGGACCAGAT
CGGAACGTGCTGGCCCCGCAGCGCTGCCGGAGCCCTCGTGGAGAGGCCGTGCCCCGAGTACTTCAACGGC
GTCAAGTACAACACGACCCGGAATGCCTATCGAGAATGCTTGGAGAATGGGACGTGGGCCTCAAAGATCA
ACTACTCACAGTGTGAGCCCATTTTGGATGACAAGCAGAGGAAGTATGACCTGCACTACCGCATCGCCCT
TGTCGTCAACTACCTGGGCCACTGCGTATCTGTGGCAGCCCTGGTGGCCGCCTTCCTGCTTTTCCTGGCC
CTGCGGAGCATTCGCTGTCTGCGGAATGTGATTCACTGGAACCTCATCACCACCTTTATCCTGCGAAATG
TCATGTGGTTCCTGCTGCAGCTCGTTGACCATGAAGTGCACGAGAGCAATGAGGTCTGGTGCCGCTGCAT
CACCACCATCTTCAACTACTTCGTGGTGACCAACTTCTTCTGGATGTTTGTGGAAGGCTGCTACCTGCAC
ACGGCCATTGTCATGACCTACTCCACTGAGCGCCTGCGCAAGTGCCTCTTCCTCTTCATCGGATGGTGCA
TCCCCTTCCCCATCATCGTCGCCTGGGCCATCGGCAAGCTCTACTATGAGAATGAACAGTGCTGGTTTGG
CAAGGAGCCTGGCGACCTGGTGGACTACATCTACCAAGGCCCCATCATTCTCGTGCTCCTGATCAATTTC
GTATTTCTGTTCAACATCGTCAGGATCCTAATGACAAAGTTACGCGCGTCCACCACATCCGAGACAATCC
AGTACAGGAAGGCAGTGAAGGCCACCCTGGTGCTCCTGCCCCTCCTGGGCATCACCTACATGCTCTTCTT
CGTCAATCCCGGGGAGGACGACCTGTCACAGATCATGTTCATCTATTTCAACTCCTTCCTGCAGTCGTTC
CAGGGTTTCTTCGTGTCTGTCTTCTACTGCTTCTTCAATGGAGAGGTGCGCTCAGCCGTGAGGAAGAGGT
GGCACCGCTGGCAGGACCATCACTCCCTTCGAGTCCCCATGGCCCGGGCCATGTCCATCCCTACATCACC
CACACGGATCAGCTTCCACAGCATCAAGCAGACGGCCGCTGTGTGA


Restriction Sites Please inquire     
ACCN NM_001883
Insert Size 1236 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001883.2, NP_001874.2
RefSeq Size 2107 bp
RefSeq ORF 1236 bp
Locus ID 1395
UniProt ID Q13324
Protein Families Druggable Genome, Transmembrane
Protein Pathways Neuroactive ligand-receptor interaction
Gene Summary The protein encoded by this gene belongs to the G-protein coupled receptor 2 family, and the subfamily of corticotropin releasing hormone receptor. This receptor shows high affinity for corticotropin releasing hormone (CRH), and also binds CRH-related peptides such as urocortin. CRH is synthesized in the hypothalamus, and plays an important role in coordinating the endocrine, autonomic, and behavioral responses to stress and immune challenge. Studies in mice suggest that this receptor maybe involved in mediating cardiovascular homeostasis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jan 2011]
Transcript Variant: This variant (1) represents the predominant transcript, and encodes isoform 1 (also known as alpha isoform).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

其它Corticotropin Releasing Factor Receptor 2产品

Customer Reviews 
Loading...