GCAP2 (GUCA1B) (NM_002098) Human Untagged Clone
CAT#: SC303119
GUCA1B (untagged)-Human guanylate cyclase activator 1B (retina) (GUCA1B)
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | GCAP 2; GCAP2; GUCA2; RP48 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_002098 edited
CTCAGGGCTAGCATGGGGCAGGAGTTTAGCTGGGAGGAGGCGGAGGCAGCTGGCGAGATA GATGTGGCGGAGCTCCAGGAGTGGTACAAGAAGTTTGTGATGGAGTGCCCCAGCGGCACA CTCTTTATGCATGAGTTTAAGCGCTTCTTCAAGGTCACAGACGATGAGGAGGCCTCCCAG TATGTAGAGGGCATGTTCCGAGCCTTCGACAAGAATGGGGACAACACCATCGACTTCCTG GAGTACGTGGCAGCTCTGAATCTCGTGCTGAGGGGCACCCTGGAGCACAAGCTGAAGTGG ACATTCAAGATCTATGATAAGGATGGCAATGGCTGCATCGACCGCCTGGAGCTACTCAAC ATTGTGGAGGGAATTTACCAGCTGAAGAAAGCCTGCCGGCGAGAGCTACAAACTGAGCAA GGCCAGCTGCTCACACCCGAGGAGGTCGTGGACAGGATCTTCCTCCTGGTGGATGAGAAT GGAGATGGCCAGCTGTCTCTGAACGAGTTTGTTGAAGGTGCCCGTCGGGACAAGTGGGTG ATGAAGATGCTGCAGATGGACATGAATCCCAGCAGCTGGCTCGCTCAGCAGAGACGGAAA AGTGCCATGTTCTGA |
Restriction Sites | Please inquire |
ACCN | NM_002098 |
Insert Size | 650 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002098.3, NP_002089.3 |
RefSeq Size | 2288 bp |
RefSeq ORF | 603 bp |
Locus ID | 2979 |
UniProt ID | Q9UMX6 |
Protein Families | Druggable Genome |
Protein Pathways | Olfactory transduction |
Gene Summary | The protein encoded by this gene is a calcium-binding protein that activates photoreceptor guanylate cyclases. This gene may have arisen due to a gene duplication event since there is a highly similar gene clustered with it on chromosome 6. Mutations in this gene can cause a form of retinitis pigmentosa. [provided by RefSeq, Nov 2009] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220183 | GUCA1B (Myc-DDK-tagged)-Human guanylate cyclase activator 1B (retina) (GUCA1B) |
CNY 2,400.00 |
|
RC220183L3 | Lenti ORF clone of Human guanylate cyclase activator 1B (retina) (GUCA1B), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC220183L4 | Lenti ORF clone of Human guanylate cyclase activator 1B (retina) (GUCA1B), mGFP tagged |
CNY 5,890.00 |
|
RG220183 | GUCA1B (tGFP-tagged) - Human guanylate cyclase activator 1B (retina) (GUCA1B) |
CNY 4,370.00 |