HOXA4 (NM_002141) Human Untagged Clone

CAT#: SC303125

HOXA4 (untagged)-Human homeobox A4 (HOXA4)



  "NM_002141" in other vectors (4)

CNY 6,270.00


货期*
2周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-HOXA4 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HOX1; HOX1D
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_002141 edited
ATTAATGACCATGAGCTCGTTTTTGATAAACTCCAACTACATCGAGCCCAAGTTCCCTCC
CTTCGAGGAGTACGCGCAGCACAGCGGCTCGGGCGGCGCAGACGGCGGCCCGGGCGGGGG
CCCCGGCTACCAGCAGCCCCCAGCGCCCCCGACCCAGCACCTGCCGCTGCAGCAGCCCCA
GCTCCCTCACGCGGGCGGCGGCCGAGAGCCCCCTGCCTCCTACTACGCGCCGCGGACCGC
CCGCGAGCCCGCCTACCCTGCTGCCGCGCTGTACCCCGCGCATGGGGCCGCGGACACCGC
CTACCCCTATGGCTACCGCGGCGGCGCCAGCCCCGGGCGGCCGCCCCAGCCCGAGCAGCC
CCCGGCGCAAGCCAAGGGCCCAGCGCACGGCCTGCATGCGAGCCACGTCCTGCAGCCCCA
GCCGCCGCCGCCCCTGCAGCCTCGCGCCGTGCCCCCAGCGGCCCCGCGGCGCTGCGAGGC
GGCCCCCGCCACCCCAGGCGTCCCGGCAGGGGGCAGCGCCCCCGCGTGCCCGCTGCTCTT
GGCCGACAAGAGCCCGCTGGGCCTGAAGGGCAAGGAGCCCGTGGTGTACCCCTGGATGAA
GAAGATCCATGTCAGCGCCGTTAACCCCAGTTATAACGGAGGGGAGCCTAAGCGCTCTCG
AACCGCCTACACCCGGCAGCAGGTCTTGGAGCTGGAGAAGGAGTTCCACTTCAATCGCTA
CCTGACCCGGCGGCGCCGCATCGAGATCGCCCACACGCTCTGTTTGTCTGAGCGCCAGGT
CAAGATCTGGTTTCAGAACCGGAGGATGAAGTGGAAGAAAGACCACAAACTGCCCAACAC
CAAGATGCGATCCTCCAATTCGGCCTCGGCCTCTGCCGGCCCACCAGGGAAAGCACAAAC
TCAGAGCCCACACCTCCATCCCCACCCCCACCCGAGCACCTCCACACCCGTTCCCTCCTC
CATATAATCTTCTAGAGATCTTAACCAGTTTCTATCCCTTACCTGC
Restriction Sites Please inquire     
ACCN NM_002141
Insert Size 1000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_002141.3, NP_002132.2
RefSeq Size 1844 bp
RefSeq ORF 1728 bp
Locus ID 3201
UniProt ID Q00056
Protein Families Transcription Factors
Gene Summary In vertebrates, the genes encoding the class of transcription factors called homeobox genes are found in clusters named A, B, C, and D on four separate chromosomes. Expression of these proteins is spatially and temporally regulated during embryonic development. This gene is part of the A cluster on chromosome 7 and encodes a DNA-binding transcription factor which may regulate gene expression, morphogenesis, and differentiation. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...