IL13 (NM_002188) Human Untagged Clone
CAT#: SC303143
IL13 (untagged)-Human interleukin 13 (IL13)
CNY 1,200.00
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | IL-13; P600 |
Vector | pCMV6-XL6 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_002188 edited
AAGCCACCCAGCCTATGCATCCGCTCCTCAATCCTCTCCTGTTGGCACTGGGCCTCATGG CGCTTTTGTTGACCACGGTCATTGCTCTCACTTGCCTTGGCGGCTTTGCCTCCCCAGGCC CTGTGCCTCCCTCTACAGCCCTCAGGGAGCTCATTGAGGAGCTGGTCAACATCACCCAGA ACCAGAAGGCTCCGCTCTGCAATGGCAGCATGGTATGGAGCATCAACCTGACAGCTGGCA TGTACTGTGCAGCCCTGGAATCCCTGATCAACGTGTCAGGCTGCAGTGCCATCGAGAAGA CCCAGAGGATGCTGAGCGGATTCTGCCCGCACAAGGTCTCAGCTGGGCAGTTTTCCAGCT TGCATGTCCGAGACACCAAAATCGAGGTGGCCCAGTTTGTAAAGGACCTGCTCTTACATT TAAAGAAACTTTTTCGCGAGGGACAGTTCAACTGAAACTTCGAAAGCATCATTATTTGCA GAGACAGGACCTGACTATTGAA |
Restriction Sites | Please inquire |
ACCN | NM_002188 |
Insert Size | 500 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_002188.2. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002188.2, NP_002179.2 |
RefSeq Size | 1282 bp |
RefSeq ORF | 441 bp |
Locus ID | 3596 |
UniProt ID | P35225 |
Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
Protein Pathways | Asthma, Cytokine-cytokine receptor interaction, Fc epsilon RI signaling pathway, Jak-STAT signaling pathway |
Gene Summary | This gene encodes an immunoregulatory cytokine produced primarily by activated Th2 cells. This cytokine is involved in several stages of B-cell maturation and differentiation. It up-regulates CD23 and MHC class II expression, and promotes IgE isotype switching of B cells. This cytokine down-regulates macrophage activity, thereby inhibits the production of pro-inflammatory cytokines and chemokines. This cytokine is found to be critical to the pathogenesis of allergen-induced asthma but operates through mechanisms independent of IgE and eosinophils. This gene, IL3, IL5, IL4, and CSF2 form a cytokine gene cluster on chromosome 5q, with this gene particularly close to IL4. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) encodes the longer isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216947 | IL13 (Myc-DDK-tagged)-Human interleukin 13 (IL13) |
CNY 1,200.00 |
|
RC216947L1 | Lenti ORF clone of Human interleukin 13 (IL13), Myc-DDK-tagged |
CNY 3,600.00 |
|
RC216947L2 | Lenti ORF clone of Human interleukin 13 (IL13), mGFP tagged |
CNY 5,890.00 |
|
RC216947L3 | Lenti ORF clone of Human interleukin 13 (IL13), Myc-DDK-tagged |
CNY 3,600.00 |
|
RC216947L4 | Lenti ORF clone of Human interleukin 13 (IL13), mGFP tagged |
CNY 3,600.00 |
|
RG216947 | IL13 (tGFP-tagged) - Human interleukin 13 (IL13) |
CNY 2,800.00 |