United States
Germany
Japan
United Kingdom
China
IL17 (IL17A) (NM_002190) Human Untagged Clone
CAT＃: SC303144
IL17A (untagged)-Human interleukin 17A (IL17A)
CNY 1,200.00
CNY 3,990.00
Product images
CNY 2,700.00
CNY 3,790.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CTLA-8; CTLA8; IL-17; IL-17A; IL17; ILA17 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_002190 edited
ATGACTCCTGGGAAGACCTCATTGGTATCACTGCTACTGCTGCTGAGCCTGGAGGCCATA GTGAAGGCAGGAATCACAATCCCACGAAATCCAGGATGCCCAAATTCTGAGGACAAGAAC TTCCCCCGGACTGTGATGGTCAACCTGAACATCCATAACCGGAATACCAATACCAATCCC AAAAGGTCCTCAGATTACTACAACCGATCCACCTCACCTTGGAATCTCCACCGCAATGAG GACCCTGAGAGATATCCCTCTGTGATCTGGGAGGCAAAGTGCCGCCACTTGGGCTGCATC AACGCTGATGGGAACGTGGACTACCACATGAACTCTGTCCCCATCCAGCAAGAGATCCTG GTCCTGCGCAGGGAGCCTCCACACTGCCCCAACTCCTTCCGGCTGGAGAAGATACTGGTG TCCGTGGGCTGCACCTGTGTCACCCCGATTGTCCACCATGTGGCCTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_002190 |
| Insert Size | 600 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_002190.2, NP_002181.1 |
| RefSeq Size | 1859 bp |
| RefSeq ORF | 468 bp |
| Locus ID | 3605 |
| UniProt ID | Q16552 |
| Protein Families | Druggable Genome, Secreted Protein |
| Protein Pathways | Cytokine-cytokine receptor interaction |
| Gene Summary | This gene is a member of the IL-17 receptor family which includes five members (IL-17RA-E) and the encoded protein is a proinflammatory cytokine produced by activated T cells. IL-17A-mediated downstream pathways induce the production of inflammatory molecules, chemokines, antimicrobial peptides, and remodeling proteins. The encoded protein elicits crucial impacts on host defense, cell trafficking, immune modulation, and tissue repair, with a key role in the induction of innate immune defenses. This cytokine stimulates non-hematopoietic cells and promotes chemokine production thereby attracting myeloid cells to inflammatory sites. This cytokine also regulates the activities of NF-kappaB and mitogen-activated protein kinases and can stimulate the expression of IL6 and cyclooxygenase-2 (PTGS2/COX-2), as well as enhance the production of nitric oxide (NO). IL-17A plays a pivotal role in various infectious diseases, inflammatory and autoimmune disorders, and cancer. High levels of this cytokine are associated with several chronic inflammatory diseases including rheumatoid arthritis, psoriasis and multiple sclerosis. The lung damage induced by the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is to a large extent, a result of the inflammatory response promoted by cytokines such as IL17A. [provided by RefSeq, Sep 2020] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC218057 | IL17A (Myc-DDK-tagged)-Human interleukin 17A (IL17A) |
CNY 1,200.00 |
|
| RC218057L1 | Lenti ORF clone of Human interleukin 17A (IL17A), Myc-DDK-tagged |
CNY 3,600.00 |
|
| RC218057L2 | Lenti ORF clone of Human interleukin 17A (IL17A), mGFP tagged |
CNY 5,890.00 |
|
| RC218057L3 | Lenti ORF clone of Human interleukin 17A (IL17A), Myc-DDK-tagged |
CNY 3,600.00 |
|
| RC218057L4 | Lenti ORF clone of Human interleukin 17A (IL17A), mGFP tagged |
CNY 3,600.00 |
|
| RG218057 | IL17A (tGFP-tagged) - Human interleukin 17A (IL17A) |
CNY 2,800.00 |
