Motilin (MLN) (NM_002418) Human Untagged Clone
CAT#: SC303197
MLN (untagged)-Human motilin (MLN), transcript variant 1
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC303197 representing NM_002418.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGTATCCCGTAAGGCTGTGGCTGCTCTGCTGGTGGTGCATGTAGCTGCCATGCTGGCCTCCCAGACG GAAGCCTTCGTCCCCATCTTCACCTATGGCGAACTCCAGAGGATGCAGGAAAAGGAACGGAATAAAGGG CAAAAGAAATCCCTGAGTGTATGGCAGAGGTCTGGGGAGGAAGGTCCTGTAGACCCTGCGGAGCCCATC AGGGAAGAAGAAAACGAAATGATCAAGCTGACTGCTCCTCTGGAAATTGGAATGAGGATGAACTCCAGA CAGCTGGAAAAGTACCCGGCCACCCTGGAAGGGCTGCTGAGTGAGATGCTTCCCCAGCATGCAGCCAAG TGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_002418 |
Insert Size | 348 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002418.2 |
RefSeq Size | 572 bp |
RefSeq ORF | 348 bp |
Locus ID | 4295 |
UniProt ID | P12872 |
Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
MW | 12.9 kDa |
Gene Summary | This gene encodes a small peptide hormone that is secreted by cells of the small intestine to regulate gastrointestinal contractions and motility. Proteolytic processing of the secreted protein produces the mature peptide and a byproduct referred to as motilin-associated peptide (MAP). Three transcript variants encoding different preproprotein isoforms but the same mature peptide have been found for this gene. [provided by RefSeq, May 2010] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222245 | MLN (Myc-DDK-tagged)-Human motilin (MLN), transcript variant 1 |
CNY 1,200.00 |
|
RC222245L3 | Lenti ORF clone of Human motilin (MLN), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC222245L4 | Lenti ORF clone of Human motilin (MLN), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG222245 | MLN (tGFP-tagged) - Human motilin (MLN), transcript variant 1 |
CNY 4,370.00 |
其它Motilin产品