Motilin (MLN) (NM_002418) Human Untagged Clone

CAT#: SC303197

MLN (untagged)-Human motilin (MLN), transcript variant 1



  "NM_002418" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
MLN Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC303197 representing NM_002418.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGTATCCCGTAAGGCTGTGGCTGCTCTGCTGGTGGTGCATGTAGCTGCCATGCTGGCCTCCCAGACG
GAAGCCTTCGTCCCCATCTTCACCTATGGCGAACTCCAGAGGATGCAGGAAAAGGAACGGAATAAAGGG
CAAAAGAAATCCCTGAGTGTATGGCAGAGGTCTGGGGAGGAAGGTCCTGTAGACCCTGCGGAGCCCATC
AGGGAAGAAGAAAACGAAATGATCAAGCTGACTGCTCCTCTGGAAATTGGAATGAGGATGAACTCCAGA
CAGCTGGAAAAGTACCCGGCCACCCTGGAAGGGCTGCTGAGTGAGATGCTTCCCCAGCATGCAGCCAAG
TGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_002418
Insert Size 348 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_002418.2
RefSeq Size 572 bp
RefSeq ORF 348 bp
Locus ID 4295
UniProt ID P12872
Protein Families Druggable Genome, Secreted Protein, Transmembrane
MW 12.9 kDa
Gene Summary This gene encodes a small peptide hormone that is secreted by cells of the small intestine to regulate gastrointestinal contractions and motility. Proteolytic processing of the secreted protein produces the mature peptide and a byproduct referred to as motilin-associated peptide (MAP). Three transcript variants encoding different preproprotein isoforms but the same mature peptide have been found for this gene. [provided by RefSeq, May 2010]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...