PDE6 gamma (PDE6G) (NM_002602) Human Untagged Clone

CAT#: SC303224

PDE6G (untagged)-Human phosphodiesterase 6G, cGMP-specific, rod, gamma (PDE6G), transcript variant 1



  "NM_002602" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


PDE6G (PDE6 gamma) mouse monoclonal antibody, clone OTI2F5 (formerly 2F5)
    • 100 ul

CNY 1,999.00
CNY 2,700.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PDEG; RP57
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC303224 representing NM_002602.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAACCTGGAACCGCCCAAGGCTGAGTTCCGGTCAGCCACCAGGGTGGCCGGGGGACCTGTCACCCCC
AGGAAAGGGCCCCCTAAATTTAAGCAGCGACAGACCAGGCAGTTCAAGAGCAAGCCCCCAAAGAAAGGC
GTTCAAGGGTTTGGGGACGACATCCCTGGAATGGAAGGCCTGGGAACAGACATCACAGTCATCTGCCCT
TGGGAGGCCTTCAACCACCTGGAGCTGCACGAGCTGGCCCAATATGGCATCATCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_002602
Insert Size 264 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_002602.3
RefSeq Size 1064 bp
RefSeq ORF 264 bp
Locus ID 5148
UniProt ID P18545
Protein Families Druggable Genome
Protein Pathways Progesterone-mediated oocyte maturation, Purine metabolism
MW 9.6 kDa
Gene Summary This gene encodes the gamma subunit of cyclic GMP-phosphodiesterase, which is composed of alpha- and beta- catalytic subunits and two identical, inhibitory gamma subunits. This gene is expressed in rod photoreceptors and functions in the phototransduction signaling cascade. It is also expressed in a variety of other tissues, and has been shown to regulate the c-Src protein kinase and G-protein-coupled receptor kinase 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2009]
Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 3, and 4 all encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...