TSPY1 (NM_003308) Human Untagged Clone
CAT#: SC303293
TSPY1 (untagged)-Human testis specific protein, Y-linked 1 (TSPY1), transcript variant 1
CNY 2,400.00
CNY 6,270.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CT78; DYS14; pJA923; TSPY |
Vector | PCMV6-Neo |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_003308 edited
AACAGGCCCTTCGCGCGCAGTCCCTTAGGGGGCGCCTGGAAGCCCGGCGCATGCGCCCTG AGGGCTCGCTGACCTACCGGGTGCCAGAGAGGCTGCGGCAGGGTTTCTGTGGCGTGGGTC GGGCAGCACAGGCCTTGGTGTGTGCGAGTGCCAAGGAGGGCACCGCCTTCAGGATGGAGG CTGTACAGGAGGGGGCGGCCGGGGTGGAGAGTGAGCAGGCGGCTTTGGGGGAGGAGGCGG TGCTGCTGTTGGATGACATAATGGCGGAGGTGGAGGTGGTGGCGGAGGAGGAGGGCCTCG TGGAGCGGCGGGAGGAGGCCCAGCGGGCACAGCAGGCTGTGCCTGGCCCTGGGCCCATGA CCCCAGAGTCTGCACTGGAGGAGCTGCTGGCCGTTCAGGTGGAGCTGGAGCCGGTTAATG CCCAAGCCAGGAAGGCCTTTTCTCGGCAGCGGGAAAAGATGGAGCGGAGGCGCAAGCCCC ACCTAGACCGCAGAGGCGCCGTCATCCAGAGCGTCCCTGGCTTCTGGGCCAATGTTATTG CAAACCACCCCCAGATGTCAGCCCTGATCACTGACGAAGATGAAGACATGCTGAGCTACA TGGTCAGCCTGGAGGTGGRAGAAGAGAAGCATCCTGTTCATCTCTGCAAGATCATGTTGT TCTTTCGGAGTAACCCCTACTTCCAGAATAAAGTGATTACCAAGGAATATCTGGTGAACA TCACAGAATACAGGGCTTCTCATTCCACTCCAATTGAGTGGTATCCGGATTATGAAGTGG AGGCCTATCGCCGCAGACACCACAACAGCAGCCTTAACTTCTTCAACTGGTTCTCTGACC ACAACTTCGCAGGATCTAACAAGATTGCTGAGATCCTATGTAAGGACCTGTGGCGCAATC CCCTGCAATACTACAAGAGGATGAAGCCACCTGAAGAGGGAACAGAGACRTCAGGGGACT CCCAGTTGTTGAGTTGAATATGATGGAGCATCAGATTTTACCTAATACAGCAGAACTCCT AAAAAGTTACAGCCATATGCAGGA |
Restriction Sites | Please inquire |
ACCN | NM_003308 |
Insert Size | 1000 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_003308.2. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_003308.2, NP_003299.1 |
RefSeq Size | 1159 bp |
RefSeq ORF | 927 bp |
Locus ID | 7258 |
UniProt ID | Q01534 |
Gene Summary | The protein encoded by this gene is found only in testicular tissue and may be involved in spermatogenesis. Many functional paralogs and pseudogenes of this gene are present in a cluster in humans, but only a single, nonfunctional orthologous gene is found in mouse. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016] Transcript Variant: This variant (1) encodes the longer isoform (TSPY-S). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222747 | TSPY1 (Myc-DDK-tagged)-Human testis specific protein, Y-linked 1 (TSPY1), transcript variant 1 |
CNY 2,400.00 |
|
RC222747L3 | Lenti-ORF clone of TSPY1 (Myc-DDK-tagged)-Human testis specific protein, Y-linked 1 (TSPY1), transcript variant 1 |
CNY 5,890.00 |
|
RC222747L4 | Lenti-ORF clone of TSPY1 (mGFP-tagged)-Human testis specific protein, Y-linked 1 (TSPY1), transcript variant 1 |
CNY 5,890.00 |
|
RG222747 | TSPY1 (tGFP-tagged) - Human testis specific protein, Y-linked 1 (TSPY1), transcript variant 1 |
CNY 4,370.00 |