United States
Germany
Japan
United Kingdom
China
Peptide YY (PYY) (NM_004160) Human Untagged Clone
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | PYY-I; PYY1 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC303444 representing NM_004160.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGTGTTCGTGCGCAGGCCGTGGCCCGCCTTGACCACAGTGCTTCTGGCCCTGCTCGTCTGCCTAGGG GCGCTGGTCGACGCCTACCCCATCAAACCCGAGGCTCCCGGCGAAGACGCCTCGCCGGAGGAGCTGAAC CGCTACTACGCCTCCCTGCGCCACTACCTCAACCTGGTCACCCGGCAGCGGTATGGGAAAAGAGACGGC CCGGACACGCTTCTTTCCAAAACGTTCTTCCCCGACGGCGAGGACCGCCCCGTCAGGTCGCGGTCGGAG GGCCCAGACCTGTGGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_004160 |
| Insert Size | 294 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_004160.5 |
| RefSeq Size | 1069 bp |
| RefSeq ORF | 294 bp |
| Locus ID | 5697 |
| UniProt ID | P10082 |
| Protein Families | Secreted Protein, Transmembrane |
| MW | 11 kDa |
| Gene Summary | This gene encodes a member of the neuropeptide Y (NPY) family of peptides. The encoded preproprotein is proteolytically processed to generate two alternative peptide products that differ in length by three amino acids. These peptides, secreted by endocrine cells in the gut, exhibit different binding affinities for each of the neuropeptide Y receptors. Binding of the encoded peptides to these receptors mediates regulation of pancreatic secretion, gut mobility and energy homeostasis. Rare variations in this gene could increase susceptibility to obesity and elevated serum levels of the encoded peptides may be associated with anorexia nervosa. [provided by RefSeq, Feb 2016] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC208334 | PYY (Myc-DDK-tagged)-Human peptide YY (PYY) |
CNY 1,200.00 |
|
| RC208334L3 | Lenti ORF clone of Human peptide YY (PYY), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC208334L4 | Lenti ORF clone of Human peptide YY (PYY), mGFP tagged |
CNY 5,890.00 |
|
| RG208334 | PYY (tGFP-tagged) - Human peptide YY (PYY) |
CNY 2,800.00 |
|
| SC320515 | PYY (untagged)-Human peptide YY (PYY) |
CNY 1,200.00 |
其它Peptide YY产品
