WNT2B (NM_004185) Human Untagged Clone

CAT#: SC303447

WNT2B (untagged)-Human wingless-type MMTV integration site family, member 2B (WNT2B), transcript variant WNT-2B1



  "NM_004185" in other vectors (6)

CNY 3,656.00

CNY 6,080.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-WNT2B Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms WNT13
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_004185 edited
ATGTTGGATGGCCTTGGAGTGGTAGCCATAAGCATTTTTGGAATTCAACTAAAAACTGAA
GGATCCTTGAGGACGGCAGTACCTGGCATACCTACACAGTCAGCGTTCAACAAGTGTTTG
CAAAGGTACATTGGGGCACTGGGGGCACGAGTGATCTGTGACAATATCCCTGGTTTGGTG
AGCCGGCAGCGGCAGCTGTGCCAGCGTTACCCAGACATCATGCGTTCAGTGGGCGAGGGT
GCCCGAGAATGGATCCGAGAGTGTCAGCACCAATTCCGCCACCACCGCTGGAACTGTACC
ACCCTGGACCGGGACCACACCGTCTTTGGCCGTGTCATGCTCAGAAGTAGCCGAGAGGCA
GCTTTTGTATATGCCATCTCATCAGCAGGGGTAGTCCACGCTATTACTCGCGCCTGTAGC
CAGGGTGAACTGAGTGTGTGCAGCTGTGACCCCTACACCCGTGGCCGACACCATGACCAG
CGTGGGGACTTTGACTGGGGTGGCTGCAGTGACAACATCCACTACGGTGTCCGTTTTGCC
AAGGCCTTCGTGGATGCCAAGGAGAAGAGGCTTAAGGATGCCCGGGCCCTCATGAACTTA
CATAATAACCGCTGTGGTCGCACGGCTGTGCGGCGGTTTCTGAAGCTGGAGTGTAAGTGC
CATGGCGTGAGTGGTTCCTGTACTCTGCGCACCTGCTGGCGTGCACTCTCAGATTTCCGC
CGCACAGGTGATTACCTGCGGCGACGCTATGATGGGGCTGTGCAGGTGATGGCCACCCAA
GATGGTGCCAACTTCACCGCAGCCCGCCAAGGCTATCGCCGTGCCACCCGGACTGATCTT
GTCTACTTTGACAACTCTCCAGATTACTGTGTCTTGGACAAGGCTGCAGGTTCCCTAGGC
ACTGCAGGCCGTGTCTGCAGCAAGACATCAAAAGGAACAGACGGTTGTGAAATCATGTGC
TGTGGCCGAGGGTACGACACAACTCGAGTCACCCGTGTTACCCAGTGTGAGTGCAAATTC
CACTGGTGCTGTGCTGTACGGTGCAAGGAATGCAGAAATACTGTGGACGTCCATACTTGC
AAAGCCCCCAAGAAGGCAGAGTGGCTGGACCAAACCTGA
Restriction Sites Please inquire     
ACCN NM_004185
Insert Size 1200 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this clone has been fully sequenced and found to be a perfect match to the protein associated with this reference, NM_004185.3.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_004185.2, NP_004176.2
RefSeq Size 2014 bp
RefSeq ORF 1119 bp
Locus ID 7482
UniProt ID Q93097
Protein Families Secreted Protein
Protein Pathways Basal cell carcinoma, Hedgehog signaling pathway, Melanogenesis, Pathways in cancer, Wnt signaling pathway
Gene Summary This gene encodes a member of the wingless-type MMTV integration site (WNT) family of highly conserved, secreted signaling factors. WNT family members function in a variety of developmental processes including regulation of cell growth and differentiation and are characterized by a WNT-core domain. This gene may play a role in human development as well as carcinogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
Transcript Variant: This variant (WNT-2B1) differs in the 5' UTR and 5' coding region, compared to variant WNT-2B2. The encoded isoform (WNT-2B1) has a shorter and distinct N-terminus, compared to isoform WNT-2B2.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...