SOX1 (NM_005986) Human Untagged Clone
CAT#: SC303713
SOX1 (untagged)-Human SRY (sex determining region Y)-box 1 (SOX1)
CNY 3,656.00
CNY 6,370.00
Cited in 1 publication. |
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_005986 edited
ATGTACAGCATGATGATGGAGACCGACCTGCACTCGCCCGGCGGCGCCCAGGCCCCCACG AACCTCTCGGGCCCCGCCGGGGCGGGCGGCGGCGGGGGCGGAGGCGGGGGCGGCGGCGGC GGCGGGGGCGCCAAGGCCAACCAGGACCGGGTCAAACGGCCCATGAACGCCTTCATGGTG TGGTCCCGCGGGCAGCGGCGCAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAG ATCAGCAAGCGCCTGGGGGCCGAGTGGAAGGTCATGTCCGAGGCCGAGAAGCGGCCGTTC ATCGACGAGGCCAAGCGGCTGCGCGCGCTGCACATGAAGGAGCACCCGGATTACAAGTAC CGGCCGCGCCGCAAGACCAAGACGCTGCTCAAGAAGGACAAGTACTCGCTGGCCGGCGGG CTCCTGGCGGCCGGCGCGGGTGGCGGCGGCGCGGCTGTGGCCATGGGCGTGGGCGTGGGC GTGGGCGCGGCGGCCGTGGGCCAGCGCCTGGAGAGCCCAGGCGGCGCGGCGGGCGGCGGC TACGCGCACGTCAACGGCTGGGCCAACGGCGCCTACCCCGGCTCGGTGGCGGCGGCGGCG GCGGCCGCGGCCATGATGCAGGAGGCGCAGCTGGCCTACGGGCAGCACCCGGGCGCGGGC GGCGCGCACCCGCACGCGCACCCCGCGCACCCGCACCCGCACCACCCGCACGCGCACCCG CACAACCCGCAGCCCATGCACCGCTACGACATGGGCGCGCTGCAGTACAGCCCCATCTCC AACTCGCAGGGCTACATGAGCGCGTCGCCCTCGGGCTACGGCGGCCTCCCCTACGGCGCC GCGGCCGCCGCCGCCGCCGCTGCGGGCGGCGCGCACCAGAACTCGGCCGTGGCGGCGGCG GCGGCGGCGGCGGCCGCGTCGTCGGGCGCCCTGGGCGCGCTGGGCTCTCTGGTGAAGTCG GAGCCCAGCGGCAGCCCGCCCGCCCCAGCGCACTCGCGGGCGCCGTGCCCCGGGGACCTG CGCGAGATGATCAGCATGTACTTGCCCGCCGGCGAGGGGGGCGACCCGGCGGCGGCAGCA GCGGCCGCGGCGCAGAGCCGGCTGCACTCGCTGCCGCAGCACTACCAGGGCGCGGGCGCG GGCGTGAACGGCACGGTGCCCCTGACGCACATCTAG |
Restriction Sites | Please inquire |
ACCN | NM_005986 |
Insert Size | 1200 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_005986.2, NP_005977.2 |
RefSeq Size | 4108 bp |
RefSeq ORF | 1176 bp |
Locus ID | 6656 |
UniProt ID | O00570 |
Protein Families | Adult stem cells, ES Cell Differentiation/IPS, Induced pluripotent stem cells, Transmembrane |
Gene Summary | This intronless gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional activator after forming a protein complex with other proteins. In mice, a similar protein regulates the gamma-crystallin genes and is essential for lens development. [provided by RefSeq, Jul 2008] |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Frequent concomitant epigenetic silencing of SOX1 and secreted frizzled-related proteins (SFRPs) in human hepatocellular carcinoma.
,null,
Journal of gastroenterology and hepatology
,PubMed ID 23215838
[SOX1]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218236 | SOX1 (Myc-DDK-tagged)-Human SRY (sex determining region Y)-box 1 (SOX1) |
CNY 3,656.00 |
|
RC218236L1 | Lenti ORF clone of Human SRY (sex determining region Y)-box 1 (SOX1), Myc-DDK-tagged |
CNY 6,056.00 |
|
RC218236L2 | Lenti ORF clone of Human SRY (sex determining region Y)-box 1 (SOX1), mGFP tagged |
CNY 6,056.00 |
|
RC218236L3 | Lenti ORF clone of Human SRY (sex determining region Y)-box 1 (SOX1), Myc-DDK-tagged |
CNY 6,056.00 |
|
RC218236L4 | Lenti ORF clone of Human SRY (sex determining region Y)-box 1 (SOX1), mGFP tagged |
CNY 6,056.00 |
|
RG218236 | SOX1 (tGFP-tagged) - Human SRY (sex determining region Y)-box 1 (SOX1) |
CNY 5,256.00 |