LBX1 (NM_006562) Human Untagged Clone
CAT#: SC303790
LBX1 (untagged)-Human ladybird homeobox 1 (LBX1)
CNY 2,400.00
CNY 6,270.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | homeobox; HPX-6; HPX6; LBX1H |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_006562 edited
ATGACTTCCAAGGAGGACGGCAAGGCGGCGCCGGGGGAGGAGCGGCGGCGCAGCCCGCTG GACCACCTGCCTCCGCCTGCCAACTCCAACAAGCCACTGACGCCGTTCAGCATCGAGGAC ATCCTCAACAAGCCGTCTGTGCGGAGAAGTTACTCGCTGTGCGGGGCGGCGCACCTGCTG GCCGCCGCGGACAAGCACGCGCAGGGCGGCTTGCCCCTGGCGGGCCGCGCGCTGCTCTCG CAGACCTCGCCGCTGTGCGCGCTGGAGGAGCTCGCCAGCAAGACGTTTAAGGGGCTGGAG GTCAGCGTTCTGCAGGCAGCCGAAGGCCGCGACGGTATGACCATCTTTGGGCAGCGGCAG ACCCCTAAGAAGCGGCGAAAGTCGCGCACGGCCTTCACCAACCACCAGATCTATGAATTG GAAAAGCGCTTTCTATACCAGAAGTACCTGTCCCCCGCCGATCGCGACCAAATCGCGCAG CAGCTGGGCCTCACCAACGCGCAAGTCATCACCTGGTTCCAGAATCGGCGCGCTAAGCTC AAGCGGGACCTGGAGGAGATGAAGGCCGACGTAGAGTCCGCCAAGAAACTGGGCCCCAGC GGGCAGATGGACATCGTGGCGCTGGCCGAACTCGAGCAGAACTCGGAGGCCACAGCCGGC GGTGGCGGCGGCTGCGGCAGGGCCAAGTCGAGGCCCGGCTCTCCGGTCCTCCCCCCAGGC GCCCCGAAGGCCCCGGGCGCTGGCGCCCTGCAGCTCTCGCCTGCCTCTCCGCTCACGGAC CAGCCGGCCAGCAGCCAGGACTGCTCGGAGGACGAGGAAGACGAAGAGATCGACGTGGAC GATTGA |
Restriction Sites | Please inquire |
ACCN | NM_006562 |
Insert Size | 800 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_006562.4, NP_006553.2 |
RefSeq Size | 1287 bp |
RefSeq ORF | 846 bp |
Locus ID | 10660 |
UniProt ID | P52954 |
Protein Families | Transcription Factors |
Gene Summary | This gene and the orthologous mouse gene were found by their homology to the Drosophila lady bird early and late homeobox genes. In the mouse, this gene is a key regulator of muscle precursor cell migration and is required for the acquisition of dorsal identities of forelimb muscles. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218048 | LBX1 (Myc-DDK-tagged)-Human ladybird homeobox 1 (LBX1) |
CNY 2,400.00 |
|
RC218048L1 | Lenti ORF clone of Human ladybird homeobox 1 (LBX1), Myc-DDK-tagged |
CNY 4,800.00 |
|
RC218048L2 | Lenti ORF clone of Human ladybird homeobox 1 (LBX1), mGFP tagged |
CNY 5,890.00 |
|
RC218048L3 | Lenti ORF clone of Human ladybird homeobox 1 (LBX1), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC218048L4 | Lenti ORF clone of Human ladybird homeobox 1 (LBX1), mGFP tagged |
CNY 5,890.00 |
|
RG218048 | LBX1 (tGFP-tagged) - Human ladybird homeobox 1 (LBX1) |
CNY 4,370.00 |