Uroguanylin (GUCA2B) (NM_007102) Human Untagged Clone
CAT#: SC303876
GUCA2B (untagged)-Human guanylate cyclase activator 2B (uroguanylin) (GUCA2B)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | GCAP-II; UGN |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC303876 representing NM_007102.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGCTGCAGGGCTGCATCAGGGCTCCTGCCAGGAGTGGCCGTGGTCCTCCTGCTGCTGCTGCAGAGC ACACAGTCAGTCTACATCCAGTACCAAGGCTTCCGGGTCCAGCTGGAATCCATGAAGAAGCTGAGTGAC CTGGAGGCACAGTGGGCACCCAGCCCCCGCCTGCAGGCCCAGAGCCTCCTGCCCGCCGTGTGCCACCAC CCTGCTCTGCCTCAGGACCTTCAGCCTGTCTGCGCCTCGCAGGAGGCTTCCAGCATCTTCAAGACCCTG AGGACCATCGCTAACGACGACTGTGAGCTGTGTGTGAACGTTGCGTGTACCGGCTGCCTCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_007102 |
Insert Size | 339 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_007102.2 |
RefSeq Size | 597 bp |
RefSeq ORF | 339 bp |
Locus ID | 2981 |
UniProt ID | Q16661 |
Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
MW | 12.1 kDa |
Gene Summary | This gene encodes a preproprotein that is proteolytically processed to generate multiple protein products, including uroguanylin, a member of the guanylin family of peptides and an endogenous ligand of the guanylate cyclase-C receptor. Binding of this peptide to its cognate receptor stimulates an increase in cyclic GMP and may regulate salt and water homeostasis in the intestine and kidneys. [provided by RefSeq, Nov 2015] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221085 | GUCA2B (Myc-DDK-tagged)-Human guanylate cyclase activator 2B (uroguanylin) (GUCA2B) |
CNY 1,200.00 |
|
RC221085L3 | Lenti ORF clone of Human guanylate cyclase activator 2B (uroguanylin) (GUCA2B), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC221085L4 | Lenti ORF clone of Human guanylate cyclase activator 2B (uroguanylin) (GUCA2B), mGFP tagged |
CNY 5,890.00 |
|
RG221085 | GUCA2B (tGFP-tagged) - Human guanylate cyclase activator 2B (uroguanylin) (GUCA2B) |
CNY 2,800.00 |
其它Uroguanylin产品