INSL6 (NM_007179) Human Untagged Clone
CAT#: SC303888
INSL6 (untagged)-Human insulin-like 6 (INSL6)
CNY 2,400.00
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | RIF1 |
Vector | pCMV6-XL6 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_007179 edited
GGAGGACTAGCCTGGGGTCACAGGGATGCCGCGGCTCCTCCGCTTGTCCCTGCTGTGGCT TGGACTCCTGCTGGTTCGGTTTTCTCGTGAACTGAGCGACATCAGCAGTGCCAGGAAGCT GTGCGGCAGGTACTTGGTGAAAGAAATAGAAAAACTCTGCGGCCATGCCAACTGGAGCCA GTTCCGTTTCGAGGAGGAAACCCCTTTCTCACGGTTGATTGCACAGGCCTCGGAGAAGGT CGAAGCCTACAGCCCATACCAGTTCGAAAGCCCGCAAACCGCTTCCCCGGCCCGGGGAAG AGGCACAAACCCAGTGTCTACTTCTTGGGAAGAAGCAGTAAACAGTTGGGAAATGCAGTC ACTACCTGAGTATAAGGATAAAAAGGGATATTCACCCCTTGGTAAGACAAGAGAATTTTC TTCATCACATAATATCAATGTATATATTCATGAGAATGCAAAATTTCAGAAGAAACGTAG AAACAAAATTAAAACCTTAAGCAATTTGTTTTGGGGGCATCATCCCCAAAGAAAACGCAG AGGATATTCAGAAAAGTGTTGTCTTACAGGATGTACAAAAGAAGAACTTAGCATTGCATG TCTTCCATATATTGATTTTAAAAGGCTAAAGGAAAAAAGATCATCACTTGTAACTAAGAT ATACTAACCATCTTAGAATTTTTTCTAACCTAATAAAAGCTTAATACATTTATTTAACTC TATTTTTTTTTGTAATTGTGCATATAAGTGATATGATGTGAAAAATGTCTGAATGTACTT GCAAGCA |
Restriction Sites | Please inquire |
ACCN | NM_007179 |
Insert Size | 800 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_007179.2, NP_009110.2 |
RefSeq Size | 711 bp |
RefSeq ORF | 642 bp |
Locus ID | 11172 |
UniProt ID | Q9Y581 |
Protein Families | Secreted Protein |
Gene Summary | The protein encoded by this gene contains a classical signature of the insulin superfamily and is significantly similar to relaxin and relaxin-like factor. This gene is preferentially expressed in testis. Its expression in testis is restricted to interstitial cells surrounding seminiferous tubules, which suggests a role in sperm development and fertilization. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214105 | INSL6 (Myc-DDK-tagged)-Human insulin-like 6 (INSL6) |
CNY 2,400.00 |
|
RC214105L3 | Lenti ORF clone of Human insulin-like 6 (INSL6), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC214105L4 | Lenti ORF clone of Human insulin-like 6 (INSL6), mGFP tagged |
CNY 5,890.00 |
|
RG214105 | INSL6 (tGFP-tagged) - Human insulin-like 6 (INSL6) |
CNY 4,000.00 |