Parkin (PARK2) (NM_013987) Human Untagged Clone
CAT#: SC304027
PARK2 (untagged)-Human parkinson protein 2, E3 ubiquitin protein ligase (parkin) (PARK2), transcript variant 2
CNY 3,656.00
CNY 7,030.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AR-JP; LPRS2; PARK2; PDJ |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_013987 edited
ATGATAGTGTTTGTCAGGTTCAACTCCAGCCATGGTTTCCCAGTGGAGGTCGATTCTGAC ACCAGCATCTTCCAGCTCAAGGAGGTGGTTGCTAAGCGACAGGGGGTTCCGGCTGACCAG TTGCGTGTGATTTTCGCAGGGAAGGAGCTGAGGAATGACTGGACTGTGCAGAATTGTGAC CTGGATCAGCAGAGCATTGTTCACATTGTGCAGAGACCGTGGAGAAAAGGTCAAGAAATG AATGCAACTGGAGGCGACGACCCCAGAAACGCGGCGGGAGGCTGTGAGCGGGAGCCCCAG AGCTTGACTCGGGTGGACCTCAGCAGCTCAGTCCTCCCAGGAGACTCTGTGGGGCTGGCT GTCATTCTGCACACTGACAGCAGGAAGGACTCACCACCAGCTGGAAGTCCAGCAGGTAGA TCAATCTACAACAGCTTTTATGTGTATTGCAAAGGCCCCTGTCAAAGAGTGCAGCCGGGA AAACTCAGGGTACAGTGCAGCACCTGCAGGCAGGCAACGCTCACCTTGACCCAGGAATTT TTCTTTAAATGTGGAGCACACCCCACCTCTGACAAGGAAACATCAGTAGCTTTGCACCTG ATCGCAACAAATAGTCGGAACATCACTTGCATTACGTGCACAGACGTCAGGAGCCCCGTC CTGGTTTTCCAGTGCAACTCCCGCCACGTGATTTGCTTAGACTGTTTCCACTTATACTGT GTGACAAGACTCAATGATCGGCAGTTTGTTCACGACCCTCAACTTGGCTACTCCCTGCCT TGTGTGGCTGGCTGTCCCAACTCCTTGATTAAAGAGCTCCATCACTTCAGGATTCTGGGA GAAGAGCAGTACAACCGGTACCAGCAGTATGGTGCAGAGGAGTGTGTCCTGCAGATGGGG GGCGTGTTATGCCCCCGCCCTGGCTGTGGAGCGGGGCTGCTGCCGGAGCCTGACCAGAGG AAAGTCACCTGCGAAGGGGGCAATGGCCTGGGCTGTGGGTTTGCCTTCTGCCGGGAATGT AAAGAAGCGTACCATGAAGGGGAGTGCAGTGCCGTATTTGAAGCCTCAGGAACAACTACT CAGGCCTACAGAGTCGATGAAAGAGCCGCCGAGCAGGCTCGTTGGGAAGCAGCCTCCAAA GAAACCATCAAGAAAACCACCAAGCCCTGTCCCCGCTGCCATGTACCAGTGGAAAAAAAT GGAGGCTGCATGCACATGAAGTGTCCGCAGCCCCAGTGCAGGCTCGAGTGGTGCTGGAAC TGTGGCTGCGAGTGGAACCGCGTCTGCATGGGGGACCACTGGTTCGACGTGTAG |
Restriction Sites | Please inquire |
ACCN | NM_013987 |
Insert Size | 1500 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_013987.1, NP_054642.1 |
RefSeq Size | 2876 bp |
RefSeq ORF | 1314 bp |
Locus ID | 5071 |
UniProt ID | O60260 |
Protein Pathways | Parkinson's disease, Ubiquitin mediated proteolysis |
Gene Summary | The precise function of this gene is unknown; however, the encoded protein is a component of a multiprotein E3 ubiquitin ligase complex that mediates the targeting of substrate proteins for proteasomal degradation. Mutations in this gene are known to cause Parkinson disease and autosomal recessive juvenile Parkinson disease. Alternative splicing of this gene produces multiple transcript variants encoding distinct isoforms. Additional splice variants of this gene have been described but currently lack transcript support. [provided by RefSeq, Jul 2008] Transcript Variant: Transcript variant 2 lacks exons 5 which is present in the full-length variant 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222635 | PARK2 (Myc-DDK-tagged)-Human parkinson protein 2, E3 ubiquitin protein ligase (parkin) (PARK2), transcript variant 2 |
CNY 3,656.00 |
|
RC222635L3 | Lenti ORF clone of Human parkinson protein 2, E3 ubiquitin protein ligase (parkin) (PARK2), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC222635L4 | Lenti ORF clone of Human parkinson protein 2, E3 ubiquitin protein ligase (parkin) (PARK2), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG222635 | PARK2 (tGFP-tagged) - Human parkinson protein 2, E3 ubiquitin protein ligase (parkin) (PARK2), transcript variant 2 |
CNY 4,370.00 |